Báo cáo y học: "Human fetal neuroblast and neuroblastoma transcriptome analysis confirms neuroblast origin and highlights neuroblastoma candidate genes" potx

... R84 Research Human fetal neuroblast and neuroblastoma transcriptome analysis confirms neuroblast origin and highlights neuroblastoma candidate genes Katleen De Preter ¤ * , Jo Vandesompele ¤ * , ... of neuroblasts and neuroblastoma tumor cells provides strong support for a neuroblast origin of neuroblast- oma and highlights new candidate neuroblastom...

Ngày tải lên: 14/08/2014, 17:22

... participated in study design and data analysis. UF and DV conceived the study and developed the study design, performed data analy- sis and prepared the manuscript. All authors read and approved the ... chondro- cytes [41] and in RA synoviocytes [18]. In animal cells IL-17A has been previously shown to act synergistically with TNF-α and OSM in upregulating proinflammatory cytok...

Ngày tải lên: 09/08/2014, 14:22

... dinaraktb@yahoo.fr; Jean-Claude Tardy - jean-claude.tardy@chu-lyon.fr; Patrice André - patrice.andre@chu-lyon.fr; Saw See Hong - sawsee.hong@sante.univ-lyon1.fr; Jean-Luc Darlix - jldarlix@ens-lyon.fr; ... laboratory work, and PB per- formed the EM analyses. PB, JCT, JLD and SSH conceived the strategies and designed the experiments. PA contrib- uted to discussion and data analysis....

Ngày tải lên: 13/08/2014, 05:22

... does HTLV-I transmit and replicate in vivo? Receptor and transmission of HTLV-I HTLV-I can infect various types of cells, such as T-lym- phocytes, B-lymphocytes, monocytes and fibroblasts [46]. Glucose ... in T-cell lymphomas and HTLV-I associated adult T-cell leukemia/lymphoma. Oncogene 2005, 24:419-430. 120. Mori N, Yamada Y, Ikeda S, Yamasaki Y, Tsukasaki K, Tanaka Y, Tomonaga...

Ngày tải lên: 13/08/2014, 09:21

... automatically highlighted (Figure 5). Friedman and Maniatis Genome Biology 2011, 12:R69 http://genomebiology.com/2011/12/7/R69 Page 5 of 11 Tasks of gene expression analysis RNA-Seq and microarray analyses ... framework for analysis of RNA-Seq and microarray gene expression data Friedman and Maniatis Friedman and Maniatis Genome Biology 2011, 12:R69 http://genomebiology.com/2011...

Ngày tải lên: 09/08/2014, 23:20

... Genome Biology 2007, 8:401 Correction Correction: Human fetal neuroblast and neuroblastoma transcriptome analysis confirms neuroblast origin and highlights neuroblastoma candidate genes Katleen ... studies on neuroblastomas mainly compared favorable with unfavorable neuroblastomas in order to identify prognostic markers or pathways that are involved in these clearly...

Ngày tải lên: 14/08/2014, 17:22

... they are the only animals that pass oocysts in their feces. They become infected by eating infected rodents, birds, or other small animals. Once oocysts are shed, they re- quire 1 to 5 days ... it is not necessary, for example, to give away one’s cat during pregnancy and that if they follow a few very simple “rules”, liv- ing with their pets need not represent any risk for infection .....

Ngày tải lên: 03/11/2012, 11:06

... O76865 and O9W4W6) and i ndicated by the arrowheads. The s ymbol ÔVÕ indicates a po ten tial N - glycosylation site. A putative polyadenylation signal is enclosed by a box. (B) Hydrophobicity plot ... m M phenylmethanesulfonyl¯uoride], and the samples were fractionated b y electrophoresis on a 12% SDS/polyacrylamide gel. The separated polypeptides were electotransferred to a poly(viny...

Ngày tải lên: 21/02/2014, 15:20

... preg- nancy. Am J Epidemiol 2001, 153: 961-968. 42. Moody GA, Probert C, Jayanthi V, Mayberry JF: The effects of chronic ill health and treatment with sulfasalazine on fertility amongst men and women ... with any NSAID use in early pregnancy and an approximate three-fold increased risk for oral clefts with early pregnancy use of NSAIDs, specifically naproxen [16]. A second case-control...

Ngày tải lên: 09/08/2014, 08:22

... 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTT COL1A2, collagen type I alpha 2; COL2A1, collagen type II alpha 1; HIF, hypoxia inducible factor; P4H, prolyl 4-hydroxylase; PHD, HIF prolyl hydroxylase; SOX, Sry-related HMG box-9. Arthritis ... microenvironment, and an oxygen Figure 3 Collagen types I and II, and SOX9 gene expression in human articular chondrocytesCollagen types I and II,...

Ngày tải lên: 09/08/2014, 10:20