... clinical forms of JRA. Materials and methods Patients In all patients included in the study, the diagnosis of JRA was established on the basis of the American College of Rheumatology (ACR) diagnostic ... autoimmune disease. Autoimmunity 2002, 35:1-14. 29. Yabuhara A, Yang FC, Nakazawa T, Iwasaki Y, Mori T, Koike K, Kawa H, Komiyama A: A killing defect of natural killer...
Ngày tải lên: 09/08/2014, 06:22
... be statis- tically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating Ang-2 (Table 2). ... cohort study [22], Ang- 2 correlated with mortality in a univariate analysis. In a surgical population with ARDS, Ang-2 predicted death with a similar discriminatory ability as the...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo y học: "Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage" ppsx
... region. Mouse Human Rat Dog fugu Zebrafish tetraodon 3‘ 5‘ 3‘ 5‘ human danio dog tetr fugu mouse rat TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAACTGCT TGGTTCAGC-AGACACTCTGGGTGATCTTTATTGAGTGAT TGGCTCAGCCAGACTCTCTGGCTCACATACACTAACTGGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAAGGGGT TGGTTCAGCCAGACTCTCTGACTCAGATACACTAAGGGGT Mouse H...
Ngày tải lên: 14/08/2014, 16:21
Báo cáo y học: " Self-reported sickness absence as a risk marker of future disability pension. Prospective findings from the DWECS/DREAM study 1990-2004"
... Study (DWECS) and the national register on social transfer payments (DREAM). DREAM is a register based on data from the Danish Ministry of Employment, the Ministry of Social Affairs and the ... increase in absence days/yr. A 10-day increase in ab- sence days per annum (scale score ranging from 0-220 days/yr) yielded an increase in disability pension risk of approximat...
Ngày tải lên: 26/10/2012, 10:03
Báo cáo y học: "Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein" pptx
... poten- tially therapeutically useful anti-inflammatory agents. The Neuroendocrine Axis The existence of salivary-derived, systemically acting, anti-inflammatory factors and the regulation of salivary gland ... University of Calgary, 3330 Hospital Drive NW, Calgary, Alberta, T2N 4N1, Canada Full list of author information is available at the end of the article Mathison et...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: " Implementing clinical guidelines in psychiatry: a qualitative study of perceived facilitators and barriers" pptx
... all participated in the design of the study. TF, YF and JH have analyzed the data. TF drafted the manuscript and all other authors participated in a critical revision of the draft as well as contributing important ... has made me critically appraise the evidence for treatment and its validity and try to improve the quality and outcome of care. It makes you aware of th...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "Pancreatic and psoas abscesses as a late complication of intravesical administration of bacillus Calmette-Guerin for bladder cancer: a case report and review of the literature" ppt
... repair of an infrarenal abdom- inal aortic aneurysm. The patient complained of abdom- inal pain in his right flank. A physical examination revealed general poor health but pulmonary and cardiac ... head and right psoas muscle diagnosed 5 years after intravesical treatment with BCG therapy for bladder cancer. Case presentation An 83-year-old Caucasian man was hospitalized with a 2-mo...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Cracked mercury dental amalgam as a possible cause of fever of unknown origin: a case report" docx
... collected the biochemical and clinical data. GG per- formed the endo-oral X-ray and managed the patient. MEF had the original idea and wrote the paper. All authors have read and approved the final manuscript. Consent Written ... of removal of the dental amalgam and the patient's symptoms resolved. Discussion This case suggests that cracked dental mercury amalgam can b...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx
... plexity of the infl ammatory process: the shedding of membrane IL-18Rα as a marker of enhanced proteolytic activity; the activation and release of IL-18 by the infl ammasome as a marker of innate ... disease activity in infl ammatory arthritis [12], indicating a local role in the pathophysiology of disease. A comparative study of diff erent biomarkers, eithe...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
... asthma medication is currently worth US$5.5 billion a year to the pharmaceutical industry [4]. Asthma is a genetically complex disease that is associated with the familial syndrome of atopy and ... genome-wide statisti- cal power as a panel of microsatellite markers is high, and there remain unresolved issues relating to appropriate sta- tistical analysis. Unfortunately,...
Ngày tải lên: 12/08/2014, 18:20