Báo cáo y học: "A class of human exons with predicted distant branch points revealed by analysis of AG dinucleotide exclusion zones" ppsx

... upstream AG as the AG exclusion zone (AGEZ). BPS, branch point sequence; dBP, distant branch point; PPT, polypyrimidine tract; 3'ss, 3' splice site. CAGYNYUR A Y YYYYYYYYYY AG 3'ssPPTBPS AGEZ α-TM exon ... R1 Research A class of human exons with predicted distant branch points revealed by analysis of AG dinucleotide exclusion zon...

Ngày tải lên: 14/08/2014, 16:20

... fac- tor, by postoperative CT scanning. While the ilio-inguinal approach may, by its very nature, give rise to arterial thrombosis, there do not appear to be any real alternatives in the management of ... preoperatively for 26 days; also, a pelvic reduction clamp had been used at surgery. The subject of thromboembolic prophylaxis is not touched upon by Probe et al. [1] In the presen...

Ngày tải lên: 11/08/2014, 10:23

... compatible with refractory hyperpar- ath yroi dism, and a diagnosis of a brown tumor of hyperparathyroidism associated with CKF was reached. The patient continued ambulatory medical treatment with vitamin ... in 1.5% to 1.7% of pati ents with secondary causes of hyperparathyroidism [4]. However, around half of patients with CKF may develop OFC due to secondary hyperparathy...

Ngày tải lên: 11/08/2014, 17:21

... end 6 5 substrate CAAAATTCCATGACAATTGTGGTGGAATGCCACTAGAAA CAAAAAACGATGAGTATGTAGGTCCATTGCCACTAGAAA CAAAATTCCATGATTATTATGGTTTAATGCCACTAGAAA CAGAGATAGGTTTGAATGTTGTTACAGTTTGGAACAAGA GAAAATCTCTAGCAGTACTGGAAGGGCTAATTCACTCCC CAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAG * * * * * * * * * * * * * * * * - ... Phylogenetic analysis of pri- mate foamy viruses by comparison of pol sequences. Virology...

Ngày tải lên: 13/08/2014, 09:21

... rates of synthesis and degradation of the receptors. With suitable choices of the parameters, good agreement with a variety of experimental data of the LH release pattern in response to pulses of ... is released by the hypothalamus in a pulsatile fashion and stimulates luteinizing hormone (LH) and follicle stimulating hor- mone (FSH) release by pituitary cells by a compl...

Ngày tải lên: 13/08/2014, 22:22

... terms divided by the total number of predicted GO terms. Coverage is calculated as the number of correctly predicted GO terms divided by the total number of known GO terms associated with each ... description of gene functions with general functions described by GO annota- tions at the top levels of the hierarchy and very precise func- tions described by terms dee...

Ngày tải lên: 14/08/2014, 14:21

... N-(2-Aminopropyl)-4-(6-(pyrimidine-2-yl)-1,2,4,5-tetrazine-3-yl)be nzamide 4 4-(6-(Pyrimidine-2-yl)-1,4-dihydro-1,2,4,5-tetrazi ne-3-yl)benzoic acid (3) was prepared from 2-cyanopyrimidine 1 a nd 4 -cyano-ben ... in Table 1. With the flow cytometry analyses we showed the high sensitivity of MC F -7 against cRGD-BioShuttle-TMZ with an IC50 value of 12.5 µM, and a much lesser sen...

Ngày tải lên: 25/10/2012, 11:40

... details 1 Department of Gastroenterological Surgery, Yokohama City University, Yokohama, Japan. 2 Division of Anatomic and Surgical Pathology, Yokohama City University Hospital, Yokohama, Japan. Authors’ ... is indicated by the presence of symptoms, a suspicion of malignancy a nd an increase in size, or the detection of, a functioning adrenal cyst. Surgical treatment may not be ne...

Ngày tải lên: 11/08/2014, 00:23

... frequently occurs between the ages of 30 and 60 often preceded by an upper respiratory infection. It may be associated with pregnancy, inflammatory bowel disease, malignancy (especially acute myeloid ... distinct entity of aseptic encephalomeningitis by Hisanaga et al. in 1999 [5]. It affects males more frequently, with a male: female ratio of 1.3 : 1. The typical age at present...

Ngày tải lên: 11/08/2014, 14:20

... intermittent symp- toms of respiratory distress, lethargy, dehydration, hypoglycemia, hypotension, hyperpigmentation and large CPAM. He was eventually diagnosed with adrenal insufficiency. He had ... patient's parenchyma. Micro- scopically, the cysts were lined with columnar (respiratory type) epithelium. This was compatible with the diagnosis of CPAM. One year later, he was re...

Ngày tải lên: 11/08/2014, 14:21