Báo cáo y học: "A class of human exons with predicted distant branch points revealed by analysis of AG dinucleotide exclusion zones" ppsx

Báo cáo y học: "A class of human exons with predicted distant branch points revealed by analysis of AG dinucleotide exclusion zones" ppsx

Báo cáo y học: "A class of human exons with predicted distant branch points revealed by analysis of AG dinucleotide exclusion zones" ppsx

... upstream AG as the AG exclusion zone (AGEZ). BPS, branch point sequence; dBP, distant branch point; PPT, polypyrimidine tract; 3'ss, 3' splice site. CAGYNYUR A Y YYYYYYYYYY AG 3'ssPPTBPS AGEZ α-TM exon ... R1 Research A class of human exons with predicted distant branch points revealed by analysis of AG dinucleotide exclusion zon...

Ngày tải lên: 14/08/2014, 16:20

19 221 0
Báo cáo y học: "External iliac artery thrombosis associated with the ilio-inguinal approach in the management of acetabular fractures: a case report." doc

Báo cáo y học: "External iliac artery thrombosis associated with the ilio-inguinal approach in the management of acetabular fractures: a case report." doc

... fac- tor, by postoperative CT scanning. While the ilio-inguinal approach may, by its very nature, give rise to arterial thrombosis, there do not appear to be any real alternatives in the management of ... preoperatively for 26 days; also, a pelvic reduction clamp had been used at surgery. The subject of thromboembolic prophylaxis is not touched upon by Probe et al. [1] In the presen...

Ngày tải lên: 11/08/2014, 10:23

5 339 0
Báo cáo y học: "A 60-year-old man with chronic renal failure and a costal mass: a case report and review of the literature" docx

Báo cáo y học: "A 60-year-old man with chronic renal failure and a costal mass: a case report and review of the literature" docx

... compatible with refractory hyperpar- ath yroi dism, and a diagnosis of a brown tumor of hyperparathyroidism associated with CKF was reached. The patient continued ambulatory medical treatment with vitamin ... in 1.5% to 1.7% of pati ents with secondary causes of hyperparathyroidism [4]. However, around half of patients with CKF may develop OFC due to secondary hyperparathy...

Ngày tải lên: 11/08/2014, 17:21

5 327 0
Báo cáo y học: " A novel function for spumaretrovirus integrase: an early requirement for integrase-mediated cleavage of 2 LTR circles" docx

Báo cáo y học: " A novel function for spumaretrovirus integrase: an early requirement for integrase-mediated cleavage of 2 LTR circles" docx

... end 6 5 substrate CAAAATTCCATGACAATTGTGGTGGAATGCCACTAGAAA CAAAAAACGATGAGTATGTAGGTCCATTGCCACTAGAAA CAAAATTCCATGATTATTATGGTTTAATGCCACTAGAAA CAGAGATAGGTTTGAATGTTGTTACAGTTTGGAACAAGA GAAAATCTCTAGCAGTACTGGAAGGGCTAATTCACTCCC CAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAG * * * * * * * * * * * * * * * * - ... Phylogenetic analysis of pri- mate foamy viruses by comparison of pol sequences. Virology...

Ngày tải lên: 13/08/2014, 09:21

18 321 0
Báo cáo y học: "A mathematical model for LH release in response to continuous and pulsatile exposure of gonadotrophs to GnRH" ppt

Báo cáo y học: "A mathematical model for LH release in response to continuous and pulsatile exposure of gonadotrophs to GnRH" ppt

... rates of synthesis and degradation of the receptors. With suitable choices of the parameters, good agreement with a variety of experimental data of the LH release pattern in response to pulses of ... is released by the hypothalamus in a pulsatile fashion and stimulates luteinizing hormone (LH) and follicle stimulating hor- mone (FSH) release by pituitary cells by a compl...

Ngày tải lên: 13/08/2014, 22:22

17 574 0
Báo cáo y học: "A first-draft human protein-interaction map" doc

Báo cáo y học: "A first-draft human protein-interaction map" doc

... terms divided by the total number of predicted GO terms. Coverage is calculated as the number of correctly predicted GO terms divided by the total number of known GO terms associated with each ... description of gene functions with general functions described by GO annota- tions at the top levels of the hierarchy and very precise func- tions described by terms dee...

Ngày tải lên: 14/08/2014, 14:21

9 266 0
 Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"

Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"

... N-(2-Aminopropyl)-4-(6-(pyrimidine-2-yl)-1,2,4,5-tetrazine-3-yl)be nzamide 4 4-(6-(Pyrimidine-2-yl)-1,4-dihydro-1,2,4,5-tetrazi ne-3-yl)benzoic acid (3) was prepared from 2-cyanopyrimidine 1 a nd 4 -cyano-ben ... in Table 1. With the flow cytometry analyses we showed the high sensitivity of MC F -7 against cRGD-BioShuttle-TMZ with an IC50 value of 12.5 µM, and a much lesser sen...

Ngày tải lên: 25/10/2012, 11:40

14 482 0
Báo cáo y học: "A giant adrenal pseudocyst presenting with right hypochondralgia and fever: a case repor" pptx

Báo cáo y học: "A giant adrenal pseudocyst presenting with right hypochondralgia and fever: a case repor" pptx

... details 1 Department of Gastroenterological Surgery, Yokohama City University, Yokohama, Japan. 2 Division of Anatomic and Surgical Pathology, Yokohama City University Hospital, Yokohama, Japan. Authors’ ... is indicated by the presence of symptoms, a suspicion of malignancy a nd an increase in size, or the detection of, a functioning adrenal cyst. Surgical treatment may not be ne...

Ngày tải lên: 11/08/2014, 00:23

5 453 0
Báo cáo y học: "A 47-year-old man with neuro-Sweet syndrome in association with Crohn’s disease: a case report" ppsx

Báo cáo y học: "A 47-year-old man with neuro-Sweet syndrome in association with Crohn’s disease: a case report" ppsx

... frequently occurs between the ages of 30 and 60 often preceded by an upper respiratory infection. It may be associated with pregnancy, inflammatory bowel disease, malignancy (especially acute myeloid ... distinct entity of aseptic encephalomeningitis by Hisanaga et al. in 1999 [5]. It affects males more frequently, with a male: female ratio of 1.3 : 1. The typical age at present...

Ngày tải lên: 11/08/2014, 14:20

4 267 0
Báo cáo y học: " A three-year-old boy with X-linked adrenoleukodystrophy and congenital pulmonary adenomatoid malformation: a case report" doc

Báo cáo y học: " A three-year-old boy with X-linked adrenoleukodystrophy and congenital pulmonary adenomatoid malformation: a case report" doc

... intermittent symp- toms of respiratory distress, lethargy, dehydration, hypoglycemia, hypotension, hyperpigmentation and large CPAM. He was eventually diagnosed with adrenal insufficiency. He had ... patient's parenchyma. Micro- scopically, the cysts were lined with columnar (respiratory type) epithelium. This was compatible with the diagnosis of CPAM. One year later, he was re...

Ngày tải lên: 11/08/2014, 14:21

5 260 0
Từ khóa:
w