Báo cáo y học: "A class of human exons with predicted distant branch points revealed by analysis of AG dinucleotide exclusion zones" ppsx
Báo cáo y học: "A class of human exons with predicted distant branch points revealed by analysis of AG dinucleotide exclusion zones" ppsx
... upstream AG as the AG exclusion zone (AGEZ).
BPS, branch point sequence; dBP, distant branch point; PPT, polypyrimidine tract; 3'ss, 3' splice site.
CAGYNYUR
A
Y
YYYYYYYYYY
AG
3'ssPPTBPS
AGEZ
α-TM
exon ... R1
Research
A class of human exons with predicted distant branch points
revealed by analysis of AG dinucleotide exclusion zon...
Báo cáo y học: "External iliac artery thrombosis associated with the ilio-inguinal approach in the management of acetabular fractures: a case report." doc
... fac-
tor, by postoperative CT scanning.
While the ilio-inguinal approach may, by its very nature,
give rise to arterial thrombosis, there do not appear to be
any real alternatives in the management of ... preoperatively for 26 days; also, a pelvic
reduction clamp had been used at surgery. The subject of
thromboembolic prophylaxis is not touched upon by
Probe et al. [1]
In the presen...
Báo cáo y học: "A 60-year-old man with chronic renal failure and a costal mass: a case report and review of the literature" docx
... compatible with refractory hyperpar-
ath yroi dism, and a diagnosis of a brown tumor of
hyperparathyroidism associated with CKF was reached.
The patient continued ambulatory medical treatment with
vitamin ... in
1.5% to 1.7% of pati ents with secondary causes of
hyperparathyroidism [4]. However, around half of
patients with CKF may develop OFC due to secondary
hyperparathy...
Báo cáo y học: " A novel function for spumaretrovirus integrase: an early requirement for integrase-mediated cleavage of 2 LTR circles" docx
... end
6
5
substrate
CAAAATTCCATGACAATTGTGGTGGAATGCCACTAGAAA
CAAAAAACGATGAGTATGTAGGTCCATTGCCACTAGAAA
CAAAATTCCATGATTATTATGGTTTAATGCCACTAGAAA
CAGAGATAGGTTTGAATGTTGTTACAGTTTGGAACAAGA
GAAAATCTCTAGCAGTACTGGAAGGGCTAATTCACTCCC
CAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAG
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
-
... Phylogenetic analysis of pri-
mate foamy viruses by comparison of pol sequences. Virology...
Báo cáo y học: "A mathematical model for LH release in response to continuous and pulsatile exposure of gonadotrophs to GnRH" ppt
... rates of synthesis and degradation of the receptors. With suitable choices of the parameters,
good agreement with a variety of experimental data of the LH release pattern in response to pulses
of ... is released by
the hypothalamus in a pulsatile fashion and stimulates
luteinizing hormone (LH) and follicle stimulating hor-
mone (FSH) release by pituitary cells by a compl...
Báo cáo y học: "A first-draft human protein-interaction map" doc
...
terms divided by the total number of predicted GO terms. Coverage is
calculated as the number of correctly predicted GO terms divided by
the total number of known GO terms associated with each ... description of gene
functions with general functions described by GO annota-
tions at the top levels of the hierarchy and very precise func-
tions described by terms dee...
Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"
...
N-(2-Aminopropyl)-4-(6-(pyrimidine-2-yl)-1,2,4,5-tetrazine-3-yl)be
nzamide 4
4-(6-(Pyrimidine-2-yl)-1,4-dihydro-1,2,4,5-tetrazi
ne-3-yl)benzoic acid (3) was prepared from
2-cyanopyrimidine 1 a nd 4 -cyano-ben ... in
Table 1. With the flow cytometry analyses we showed
the high sensitivity of MC F -7 against
cRGD-BioShuttle-TMZ with an IC50 value of 12.5 µM,
and a much lesser sen...
Báo cáo y học: "A giant adrenal pseudocyst presenting with right hypochondralgia and fever: a case repor" pptx
... details
1
Department of Gastroenterological Surgery, Yokohama City University,
Yokohama, Japan.
2
Division of Anatomic and Surgical Pathology, Yokohama
City University Hospital, Yokohama, Japan.
Authors’ ... is
indicated by the presence of symptoms, a suspicion of
malignancy a nd an increase in size, or the detection of,
a functioning adrenal cyst. Surgical treatment may not
be ne...
Báo cáo y học: "A 47-year-old man with neuro-Sweet syndrome in association with Crohn’s disease: a case report" ppsx
... frequently occurs
between the ages of 30 and 60 often preceded by an
upper respiratory infection. It may be associated with
pregnancy, inflammatory bowel disease, malignancy
(especially acute myeloid ... distinct
entity of aseptic encephalomeningitis by Hisanaga et al. in
1999 [5]. It affects males more frequently, with a male:
female ratio of 1.3 : 1. The typical age at present...
Báo cáo y học: " A three-year-old boy with X-linked adrenoleukodystrophy and congenital pulmonary adenomatoid malformation: a case report" doc
... intermittent symp-
toms of respiratory distress, lethargy, dehydration,
hypoglycemia, hypotension, hyperpigmentation and
large CPAM. He was eventually diagnosed with adrenal
insufficiency. He had ... patient's parenchyma. Micro-
scopically, the cysts were lined with columnar (respiratory
type) epithelium. This was compatible with the diagnosis
of CPAM.
One year later, he was re...
Từ khóa: