Báo cáo y học: "oinformatics with a French accent" docx
Báo cáo y học: "oinformatics with a French accent" docx
... that are usually left to manual curators. She compared the new method, known as Exogean, with eight other annotation methods, using manually anno- tated human genes as a benchmark. Exogean gave ... history of genes. Alexandra Calteau (Université Claude Bernard, Lyon, France) showed, for example, that two hyperthermophilic bacteria (Aquifex aeolicus and Thermotoga maritima) obtained many o...
Ngày tải lên: 14/08/2014, 14:22
Báo cáo y học: " Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of coxsackievirus b3-induced viral myocarditis reduces myocardium inflammation" pdf
... sense: 5’CACAGAAGGAGTGGCTAAGGACCA3’ antisense: 5’ACGCACTAGGTTTGCCGAGTAGA3’ 103 bp IL-17[GenBank:16171] sense: 5’GTCAATGCGGAGGGAAAG3’ antisense: 5’CACGAAGCAGTTTGGGAC 3’ 349 bp TNF -a GenBank:21926] sense: ... 5’CACTGGAGCCTCGAATGTC3’ antisense: 5’CAGGGAAGAATCTGGAAAGGT3’ 128 bp b-actin [GenBank:11461] sense: 5’CCAGCCTTCCTTCTTGGGTAT3’ antisense: 5’TTGGCATAGAGGTCTTTACGG 3’ 102 bp Fan et al. Virol...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... after the emergency medical call centre organization reform in Finland. Material and methods A retrospective observational study was conducted in the EMCC in East and Central Uusimaa, an area ... - an evaluation, with performance indicators. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2011 19:19. Submit your next manuscript to BioMed Central and take full advantag...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic ... correctly diagnose ALS and as- sociates with clinical severity Quantitative ELISA assay revealed that the de- creased CSF levels of total full-length Vgf (P<0.05), correctly dia...
Ngày tải lên: 03/11/2012, 10:52
Tài liệu Báo cáo Y học: Evidence that a eukaryotic-type serine/threonine protein kinase from Mycobacterium tuberculosis regulates morphological changes associated with cell division docx
... autophosphorylating ability o f PknA is strictly magnesium/manganese-dependent, and sodium orthovanadate can inhibit this activity. Phosphoamino-acid analysis ind icated that PknA phosphorylates at serine and threonine ... is an indispensable virulence determinant. Nature 361, 730–732. 11. Mukhopadhyay, S., Kapatral, V., Xu, W. & Chakrabarty, A. M. (1999) Characterization of a Hank’s t...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx
... ontaining an XbaI site a s follows: 5¢-ATGCAGGTCTCCCGTGTGC-3¢,5¢-AT TCTAGAG GCTAGGTTGTTGGAAAG-3¢,5¢-AT TCTAGAGGAT GTCTTGAGCCCCTG-3¢ and 5¢-TTCTCGAGCAGGA CTGAGCATTAACAG-3¢. The two DNA fragments ... end (5¢-TA GAATTCCACCATGCAGGTCTCCCGT-3¢)and an EcoRV site at the 3¢ end (5¢-CA GATATCTTAACAGC CCAGCAGCTC-3¢). The cDNA lacking the C2 domain (amino acids 307–463) was created by PCR directly from...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... Hospital Universitario de Salamanca, Salamanca, Spain. 2 Department of Psychiatry, Hospital del Henares, Coslada, Madrid, Spain. 3 BAP Health Outcomes Research, Oviedo, Spain. 4 Value Demonstration Unit, ... group. Data tabulation, database validation and the statistical analyses were carried out using the statistical packages SPSS (version 14.0; SPSS, Chicago, IL, USA) and Stata (version10.0...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Association of a specific haplotype across the genes MMP1 and MMP3 with radiographic joint destruction in rheumatoid arthritis" ppt
... sclerosing cholangitis. Gastroenterology 2001, 121:124-130. 25. Terashima M, Akita H, Kanazawa K, Inoue N, Yamada S, Ito K, Matsuda Y, Takai E, Iwai C, Kurogane H, Yoshida Y, Yokoyama M: Stromelysin promoter ... analysis Radiographic damage of hands and feet was assessed by the Ratingen score [28], a modification of the Larsen score. It evaluates 38 joints separately (all proximal inter-...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... (Rheumaklinik Aachen, Aachen, Germany), Prof. Dr MJ Fritzler (University of Calgary, Calgary, Canada) and by Labor Limbach (Heidelberg, Germany). To assess further the assay specificity, we analyzed ... the anti-SmD3 peptide (SMP) assayAssay performance characteristics of the anti-SmD3 peptide (SMP) assay. (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "ADAMTS proteinases: a multi-domain, multi-functional family with roles in extracellular matrix turnover and arthritis" pdf
... elegans. They form part of subfamily B (adamalysin subfamily), family M12, in clan MA of the metallopeptidases, as defined in the MEROPS database [5,6] and are structurally and evolutionarily related to ... the ADAM (a disintegrin and metalloproteinase; also part of the adamalysin subfamily) enzymes and, more distantly, the matrix metalloproteinase (MMP; family M10 in clan MA) enzymes. A c...
Ngày tải lên: 09/08/2014, 06:23