Báo cáo y học: "E-Predict: a computational strategy for species identification based on observed DNA microarray hybridization patterns" pot

Báo cáo y học: "E-Predict: a computational strategy for species identification based on observed DNA microarray hybridization patterns" pot

Báo cáo y học: "E-Predict: a computational strategy for species identification based on observed DNA microarray hybridization patterns" pot

... Bacterial species determination from DNA- DNA hybridization by using genome fragments and DNA microarrays. Appl Environ Microbiol 2001, 67:3677-3682. 39. Eisen MB, Brown PO: DNA arrays for analysis ... labeled DNA is then hybridized to the microarray, and hybridization patterns are analyzed to identify particular viruses that are present in the sample. Here we report a co...

Ngày tải lên: 14/08/2014, 14:22

14 331 0
Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

... the computational analysis. WS and DH analyzed the data. WS, DH and ML wrote the manuscript. All authors read and approved the final manuscript. Acknowledgements We thank Benjamin Haley for sharing ... S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, Suzuki H, Carninci P, Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mat...

Ngày tải lên: 09/08/2014, 20:21

12 553 0
Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot

Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot

... interaction variable may have several observa- tion variables if the pair appears in multiple assays. For those assays with binary observations, T ij .O n is a binary variable and the probability ... mostly post- translational modification motifs that appear across many proteins. We removed motifs that are annotated as 'Composi- tionally biased' or &apos ;DNA or RNA associated...

Ngày tải lên: 14/08/2014, 08:20

18 251 0
Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx

Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx

... of 13 are examples of metadata) - to repeat an analysis exactly. When a user performs an analysis using Galaxy, it automatically generates metadata for each analysis step. Galaxy’s metadata includes ... a computational biology experiment. Galaxy provides a framework for perform- ing computational analyses, systematically repeating ana- lyses, capturing all details of performed a...

Ngày tải lên: 09/08/2014, 20:22

13 400 0
Báo cáo y học: "TWEAK: a novel biomarker for lupus nephritis" pot

Báo cáo y học: "TWEAK: a novel biomarker for lupus nephritis" pot

... inadequate because substantial renal tissue damage can occur before function is impaired to a detectable extent [4]. Renal biopsy remains the gold standard for assessment of LN disease activity. ... injury has anti- inflammatory effects [5]. In the current paper by Schwartz and colleagues, TWEAK was assessed as a biomarker for LN in both cross-sectional and longitudinal studies. In th...

Ngày tải lên: 09/08/2014, 14:22

3 337 0
Báo cáo y học: " NeMeSys: a biological resource for narrowing the gap between sequence and function in the human pathogen Neisseria meningitid" pot

Báo cáo y học: " NeMeSys: a biological resource for narrowing the gap between sequence and function in the human pathogen Neisseria meningitid" pot

... biochemical pathway (for sulfur metabolism) that may potentially be important for nasopharyngeal colonization. Conclusions: By improving our capacity to understand gene function in an important human pathogen, ... tools and bioinformatics methods for annotation; a web graphical interface (MaGe) for data visualization and exploration; and the large Prokaryotic Genome DataBase (PkDGB)...

Ngày tải lên: 09/08/2014, 20:20

13 552 0
Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf

Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf

... PE read, ge ne annotation sets, expression values, and so on. Software and data availability FusionSeq is available for download at [34]. Data sets used in this study are available via dbGaP [55] ... of each pri- mer (forward, TMPRSS2 exon 1 - TAGGCGC GAGCTAAGCAGGAG; reverse, ERG exon 5 - GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al. [23]) and 50 ng cDNA at an annealing temper...

Ngày tải lên: 09/08/2014, 22:23

19 519 0
Báo cáo y học: "Towards a better understanding of the role of psychological variables in arthritis outcome research" potx

Báo cáo y học: "Towards a better understanding of the role of psychological variables in arthritis outcome research" potx

... widely integrated when the biopsychosocial model of disease was adopted by the World Health Organization, through the approval of the International Classifi cation of Functioning, Disability and ... patients with ankylosing spondylitis. Arthritis Res Ther 2009, 11:R182. 2. International Classi cation of Functioning, Disability and Health. Geneva: World Health Organisation; 2001. 3. Zaut...

Ngày tải lên: 12/08/2014, 11:22

3 257 0
Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx

Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx

... 5’-GGGTCAAGATCGCCG AAGTA-3’; reverse primer for TXNDC5, 5’ -GCCTCCA CTGTGCTCACTGA-3’;forwardprimerforhumanb- actin, 5’-TGGCACCCAGCACAATGAA-3’;andreverse primer for human b-actin, 5’-CTAAGTCATAGTCCGCC- TAGAAGCA-3’. ... TaqMan SNP genotyp- ing assays in a cohort of 950 patients with RA (693 female) and 900 healthy controls (630 female). RA patients had a mean age of 46.2 years and were...

Ngày tải lên: 12/08/2014, 17:22

16 321 0
Báo cáo y học: " Pruritus: a useful sign for predicting the haemodynamic changes that occur following administration of vancomycin" ppsx

Báo cáo y học: " Pruritus: a useful sign for predicting the haemodynamic changes that occur following administration of vancomycin" ppsx

... physician to identify at an early stage those patients who are at risk for hypoten- sion (e.g. hypovolaemic patient) and to compensate for hypo- volaemia before continuing administration of vancomycin. This ... devices had been positioned (electrocar- diograph leads DII–V5 for ST-segment analysis; radial artery cannula and pulmonary artery catheter [Arrow AH 050050-H, 7.5 F; Arrow Inter...

Ngày tải lên: 12/08/2014, 18:21

6 260 0
w