Báo cáo y học: "E-Predict: a computational strategy for species identification based on observed DNA microarray hybridization patterns" pot
Báo cáo y học: "E-Predict: a computational strategy for species identification based on observed DNA microarray hybridization patterns" pot
... Bacterial species determination from DNA-
DNA hybridization by using genome fragments and DNA
microarrays. Appl Environ Microbiol 2001, 67:3677-3682.
39. Eisen MB, Brown PO: DNA arrays for analysis ... labeled
DNA is then hybridized to the microarray, and hybridization
patterns are analyzed to identify particular viruses that are
present in the sample.
Here we report a co...
Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx
... the computational analysis. WS and DH analyzed the
data. WS, DH and ML wrote the manuscript. All authors read and approved the
final manuscript.
Acknowledgements
We thank Benjamin Haley for sharing ... S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M,
Nishida H, Yap CC, Suzuki M, Kawai J, Suzuki H, Carninci P, Hayashizaki Y,
Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mat...
Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot
... interaction variable may have several observa-
tion variables if the pair appears in multiple assays. For those
assays with binary observations, T
ij
.O
n
is a binary variable and
the probability ... mostly post-
translational modification motifs that appear across many
proteins. We removed motifs that are annotated as 'Composi-
tionally biased' or &apos ;DNA or RNA associated...
Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx
... of 13
are examples of metadata) - to repeat an analysis
exactly. When a user performs an analysis using Galaxy,
it automatically generates metadata for each analysis
step. Galaxy’s metadata includes ... a computational biology
experiment. Galaxy provides a framework for perform-
ing computational analyses, systematically repeating ana-
lyses, capturing all details of performed a...
Báo cáo y học: "TWEAK: a novel biomarker for lupus nephritis" pot
... inadequate because
substantial renal tissue damage can occur before function is
impaired to a detectable extent [4]. Renal biopsy remains the
gold standard for assessment of LN disease activity. ... injury has anti-
inflammatory effects [5].
In the current paper by Schwartz and colleagues, TWEAK
was assessed as a biomarker for LN in both cross-sectional
and longitudinal studies. In th...
Báo cáo y học: " NeMeSys: a biological resource for narrowing the gap between sequence and function in the human pathogen Neisseria meningitid" pot
... biochemical pathway (for
sulfur metabolism) that may potentially be important for nasopharyngeal colonization.
Conclusions: By improving our capacity to understand gene function in an important human
pathogen, ... tools and
bioinformatics methods for annotation; a web graphical
interface (MaGe) for data visualization and exploration; and
the large Prokaryotic Genome DataBase (PkDGB)...
Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf
... PE read, ge ne annotation sets, expression
values, and so on.
Software and data availability
FusionSeq is available for download at [34]. Data sets
used in this study are available via dbGaP [55] ... of each pri-
mer (forward, TMPRSS2 exon 1 - TAGGCGC
GAGCTAAGCAGGAG; reverse, ERG exon 5 -
GTAGGCACACTCAAACAACGACTGG; as published
by Tomlins et al. [23]) and 50 ng cDNA at an annealing
temper...
Báo cáo y học: "Towards a better understanding of the role of psychological variables in arthritis outcome research" potx
... widely
integrated when the biopsychosocial model of disease
was adopted by the World Health Organization, through
the approval of the International Classifi cation of
Functioning, Disability and ... patients with ankylosing spondylitis. Arthritis Res
Ther 2009, 11:R182.
2. International Classi cation of Functioning, Disability and Health. Geneva: World
Health Organisation; 2001.
3. Zaut...
Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx
... 5’-GGGTCAAGATCGCCG
AAGTA-3’; reverse primer for TXNDC5, 5’ -GCCTCCA
CTGTGCTCACTGA-3’;forwardprimerforhumanb-
actin, 5’-TGGCACCCAGCACAATGAA-3’;andreverse
primer for human b-actin, 5’-CTAAGTCATAGTCCGCC-
TAGAAGCA-3’. ... TaqMan SNP genotyp-
ing assays in a cohort of 950 patients with RA (693 female)
and 900 healthy controls (630 female). RA patients had a
mean age of 46.2 years and were...
Báo cáo y học: " Pruritus: a useful sign for predicting the haemodynamic changes that occur following administration of vancomycin" ppsx
... physician to identify
at an early stage those patients who are at risk for hypoten-
sion (e.g. hypovolaemic patient) and to compensate for hypo-
volaemia before continuing administration of vancomycin.
This ... devices had been positioned (electrocar-
diograph leads DII–V5 for ST-segment analysis; radial artery
cannula and pulmonary artery catheter [Arrow AH 050050-H,
7.5 F; Arrow Inter...