Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx
Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx
... CATTTGCCACTCACGAACAAGAATAAAAGAATTTAGGTATTCTAGAATGCCCAAAAGGTAACGGCAATACA
YLR387C_Skud AAATTGCCACTTACGAAGGAGAATAAAACAGCTCAGATATTCTTAGACACTCCAAGGGCAGTGACAATACA
YLR387C_Sbay AAATTGCCACTCAGGAAAGAGAAGTGATATAATTAGATGTTCT ... region.
YLR387C_Scer AAATTGCCACTCACGAAAGAGAATAAAACGACTTAGTCAT-ATGCAATAGTCACAAGACGGTGGCAACACA
YLR387C_Spar AAATTGCCACTCACGAAGGAGAATAAAACAACTCAGTCGTCATGCAATACCCAAAAGACGGTGGCAATAAA...
Tài liệu Báo cáo Y học: Prediction of protein–protein interaction sites in heterocomplexes with neural networks ppt
... predicted as
receptor -binding domains [26] and a Supp ort Vector
Machine learning system was trained to recognize and
predict interactions based solely on primary structure and
associated physico-chemical ... protein–protein
interfaces taken from the PDB database indicates that
hydrophobic residues are abundant in large interfaces while
polar residues are more abundant in small intera...
Báo cáo y học: "Risk factors associated with mental illness in Oyo State, Nigeria: A Community based study" pps
... Health, Saki East
Local Govt Area, Oyo State, Nigeria
Email: OE Amoran* - drfamoran@yahoo.com; TO Lawoyin - tlawoyin@skannet.com; OO Oni - rindeoni@yahoo.com
* Corresponding author
Abstract
Background: ... all the local government areas in Oyo
state was drawn and stratified into urban and rural areas
based on World bank classification [9]. One rural and two
urban local government areas wa...
Báo cáo y học: "Do the pleiotropic effects of statins in the vasculature predict a role in inflammatory diseases" pdf
... statins are
currently available within the UK: pravastatin, simvastatin,
fluvastatin, atorvastatin and rosuvastatin; in addition,
lovastatin is available in other countries. Cerivastatin has
been ... Sparrow and colleagues
demonstrated that simvastatin had a comparable anti-
inflammatory effect to that of indomethacin in the
carrageenan-induced foot pad oedema inflammatory
model [43]....
Báo cáo y học: "New classification of HLA-DRB1 alleles in rheumatoid arthritis susceptibility: a combined analysis of worldwide samples" docx
... HLA shared-epitope genotypes for rheumatoid
arthritis. Am J Hum Genet 1996, 58:371-383.
23. Kochi Y, Yamada R, Kobayashi K, Takahashi A, Suzuki A, Sekine A,
Mabuchi A, Akiyama F, Tsunoda T, Nakamura ... USA) and the help of technical
and clinical collaborators from the rheumatoid arthritis international
working group, for clinical data management and laboratory typings. The
authors a...
Báo cáo y học: "Antiretroviral treatment adherence and its determinants in Sub-Saharan Africa: a prospective study at Yaounde Central Hospital, Cameroon" pdf
... characteristics and
pharmacy adherence
As patients lost to follow-up may have introduced bias
into the analysis, we analysed the association of individ-
ual patient characteristics with pharmacy ... Kinge: scientific advisor and technical assistance;
Bibiane Bekono Ntsama: data cleaning and processing; Dominique Roulin,
Prof Jean-François Balavoine, Eric Linder and Renaud Gautier: main ......
Báo cáo y học: "Three variations of the laryngeal nerve in the same patient: a case report" potx
... posterior branch also has
motor fibers, and may affect laryngeal function. It may
innervate posterior cr icoarytenoid (abductor function)
and interarytenoid muscles [4]. Extra-laryngeal terminal
division ... SILAB appeared as additional third variation of
RLN in our patient. Extra-laryngeal bifurcation of the
non-recurrent ILN is an extremely unusual anatomic
finding. Association of two ana...
Báo cáo y học: "Gabapentin for complex regional pain syndrome in Machado-Joseph disease: a case report" pot
... worldwide and is caused by a CAG
trinucleotide repeat expansion in the coding region of
the MJD1 gene. The main features of MJD are ataxia
and ophthalmoparesis and pyramidal, extrapyram idal,
and amyotrophic ... visual analogue scale
(VAS) (0 for no pain and 10 for maximal pain) to mea-
sure his pain intensity [3]. Initially, his pain was mini-
mally relieved, from 10 to 8 on the VAS, by...
Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" potx
... residual calcium may be seen [2]. One
case of a recurrent cardiac CAT in a young patient has
also been reported [3]. Another patient, a 60-year-old
woman, had a fatal outcome of a cardiac CAT involving
right ... Marusaki S, Moniwa N, Oh-numa Y, Kuno A,
Takagi S, Takizawa H, Ura N, Shimamoto K: Mobile intracardiac calcinosis:
a new risk of thromboembolism in patients with ha...
Báo cáo y học: "Calcified amorphous tumor of the heart in an adult female: a case report" docx
... impera-
tive to exclude underlying myxomas [2]. In our case,
extensive sampling failed to reveal any myxomatous tis-
sue. Cardiac vegetations are intimately associated with
valve leaflets and may ... histological differential diagnoses for car-
diac CAT include myxoma, vegetations, Echinococcus
cysts and thrombi. A small fraction of myxomas may cal-
cify and even ossify; hence, adequate s...
Từ khóa: