Báo cáo y học: "A reverse genetic screen in Drosophila using a deletion-inducing mutagen" doc

Báo cáo y học: "A reverse genetic screen in Drosophila using a deletion-inducing mutagen" doc

Báo cáo y học: "A reverse genetic screen in Drosophila using a deletion-inducing mutagen" doc

... AGATCGTTGCACATCGGCCCAATATATAATACATATAACAACTAAACGATCAAAACGATC R32F3 AGATCGTTGCACATCGGCCCAATATATAATACATATAACAACTAAACGATCAAAACGATC WT AGCAATGAGGCTGTTTTTGCGAAGTAACTCGAC TAAACCGCGATCGCATTGT R32F3 AGCAATGAGGCTGTTTTTGCGAAGTAACTCGACCGAGTAAC ... wild-type and the mutant alleles starting at an ATG originally annotated as the first codon in the CG15000 ORF are aligned below. WT ATGGGCGGTGATGATGTGCAGC...

Ngày tải lên: 14/08/2014, 14:21

10 260 0
Báo cáo y học: "Elimination of rheumatoid synovium in situ using a Fas ligand ''''gene scalpel" pptx

Báo cáo y học: "Elimination of rheumatoid synovium in situ using a Fas ligand ''''gene scalpel" pptx

... by Ad-LacZ in cartilage, as demonstrated by X-gal/hematoxylin and eosin staining (original magnification 200×). A variety of cell types including (g) syn- oviocytes, (h) lymphocytes, (i) macrophages, ... Takeba Y, Shimoyama H, Nagafuchi H, Tak- eno M, Saito N, Yokoe T, Kaneko T, Asai T, Sakane T: Modulation by proinflammatory cytokines of Fas/Fas ligand-mediated apoptotic cell death of...

Ngày tải lên: 09/08/2014, 07:20

9 505 0
Báo cáo y học: "Role of Genetic Polymorphisms in Therapeutic Response to Anti-Asthma Therapy" pot

Báo cáo y học: "Role of Genetic Polymorphisms in Therapeutic Response to Anti-Asthma Therapy" pot

... one, as once understood, we may be able to rely on a patient’s genetics to aid in choosing the most appropriate therapy. As clinicians attempting to stay current in the evolving science of asthma, ... response. Although, initially, the nomenclature associated with examining genetic poly- morphisms (GPs) may seem like bringing meaning to alphabet soup, it is quite likely that further a...

Ngày tải lên: 08/08/2014, 21:20

3 387 0
Báo cáo y học: "morbidity of overseas patients in inner London: A hospital based study" ppsx

Báo cáo y học: "morbidity of overseas patients in inner London: A hospital based study" ppsx

... suffering from mental disorder, especially those placed as involuntary patients in a psychiatric establishment. Strasbourg 2000. 37. Green L, Nayani T: Repatriating psychiatric patients. Psychiatr Bull ... financial planning; thus facilitating their inclusion in user and information groups, and strategies aimed at improving standards of care. Recent changes to the Charging Regulations f...

Ngày tải lên: 08/08/2014, 21:20

11 651 0
Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

... result, C 5a may be generated via thrombin-mediated coagula- tion abnormalities that have been documented in anor- exia nervosa patients [17,18]. In addition, phacocytic cells are able to directly cleave ... follow-up, days NA 49.4 ± 31.7 b NA a Statistical analysis compares differences between cohorts using t test and Fisher’s exact test as appropriate. Data are expressed as mean ±...

Ngày tải lên: 09/08/2014, 01:21

6 441 0
Báo cáo y học: "α Tumor necrosis factor-α blockade in ankylosing spondylitis: a potent but expensive anti-inflammatory treatment or true disease modification" pps

Báo cáo y học: "α Tumor necrosis factor-α blockade in ankylosing spondylitis: a potent but expensive anti-inflammatory treatment or true disease modification" pps

... by Baraliakos et al., http://arthritis-research.com/content/7/3/R439 123 decrease in the hypervascularity typical of SpA and a reduction of the synovial lining hyperplasia, indicating that infliximab ... pathophysiological mechanisms that for example lead to ankylosis in AS? An interesting addition to our knowledge of TNF-α blockade with infliximab in AS has been provided in a rec...

Ngày tải lên: 09/08/2014, 06:23

3 290 0
Báo cáo y học: " Predictors of disease progression in HIV infection: a review" ppt

Báo cáo y học: " Predictors of disease progression in HIV infection: a review" ppt

... readily measurable markers of disease such as total lymphocyte count, haemoglobin, body mass index and delayed type hypersensitivity may come into favour as ART becomes increasingly available in ... mostly in Southern and Eastern Africa, India and China. Subtype D is found in East Africa and Subtype CRF_01 AE is seen mainly in Thailand. Cau- casians are predominantly infected by subty...

Ngày tải lên: 10/08/2014, 05:20

14 485 0
Báo cáo y học: "Hazards of tube thoracostomy in patients on a ventilator" doc

Báo cáo y học: "Hazards of tube thoracostomy in patients on a ventilator" doc

... h as been deployed as a standard approach to tube thoracost- omy in both practice and training programs. Recently there is an increasing concern regarding the t raining of doctors with regard ... CAS E REP O R T Open Access Hazards of tube thoracostomy in patients on a ventilator Kasra Shaikhrezai * and Vipin Zamvar Abstract A patient with post-pneumonia empyema complicated by type-...

Ngày tải lên: 10/08/2014, 09:21

2 383 0
Báo cáo y học: "Antiphospholipid syndrome; its implication in cardiovascular diseases: a review" pdf

Báo cáo y học: "Antiphospholipid syndrome; its implication in cardiovascular diseases: a review" pdf

... manifestations in APLS include valvular di sease, coronary artery disease, intracardiac thrombus f orma- tion, pulmonary hypertension and dilated cardiomyopa- thy [5,8]. Cardiac valvular pathology includes ... 346:752-63. 30. Nakayama M, Kumon K, Yahagi N, et al: Antiphospholipid antibody syndrome in a case with redo coronary artery bypass grafting under cardiopulmonary bypass. Surg Tod...

Ngày tải lên: 10/08/2014, 09:22

10 329 0
Báo cáo y học: "Inhibition of oncogene-induced inflammatory chemokines using a farnesyltransferase inhibitor" pot

Báo cáo y học: "Inhibition of oncogene-induced inflammatory chemokines using a farnesyltransferase inhibitor" pot

... [sense: 5' GCGGAGAGATGAGAGTCTGG 3'; antisense: 5' GAGAC- GAGAAGGAGCATTGG 3']; human RP3 (breakpoint region) [sense: 5' CCAGAGCAGAAGTCAGCATTC 3'; anti- sense: 5' ... treatment of advanced malignancies in clinical tri- als. One explanation for these failures may be that FTIs modulate alternate targets and the assumed dependency on Ras signaling in cancer m...

Ngày tải lên: 11/08/2014, 08:21

8 306 0
Từ khóa:
w