Báo cáo y học: "Development of a method for screening short-lived proteins using green fluorescent protein" pps

... polyclonal anti- body against GFP (Clontech), a monoclonal antibody against the Myc epitope (Sigma), a polyclonal antibody against G pro- tein (Santa Cruz) or an antibody against Hsp70 (Santa Cruz). Bands ... T, Alkalay I, Kronke M., Ben-Neriah Y, Baeuuerle PA: Rapid proteolysis of I kappa B-alpha is necessary for acti- vation of transcription factor NF-kappa B. Nature 1993, 365:18...

Ngày tải lên: 14/08/2014, 14:21

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis a...

Ngày tải lên: 10/08/2014, 21:23

... SDS/PAGE. Autoradio- graphy was carried out on a BAS-IP NP 2040P imaging plate. Radioactivity was monitored with a Fujix BAS 2000 scanner (Raytest, Straubenhardt). Gel documentation was accomplished ... Germany; 2 Institute for Molecular Biosciences, The University of Queensland, St Lucia, Australia A novel photoactivatable analog of antisauvagine-30 (aSvg- 30), a specific antago...

Ngày tải lên: 31/03/2014, 08:20

... the DAS28. If val- idated as a measure of RA disease severity, the CIRAS may serve as a potentially important tool in adjusting for RA severity in pharmacoepidemiology studies of RA treatment and ... the medical chart review. Using Spearman non-parametric tests, the correlations between the RARBIS and various forms of administrative data variables were then analysed. Data taken...

Ngày tải lên: 09/08/2014, 10:23

... Virgili A, Corazza M: Guess what! Metastatic malignant melanoma of the leg from a warty acral amelanotic malignant melanoma. Eur J Dermatol 2001, 11:591-592. 37. Fountain JA: Recognition of subungual ... and consequences of physician delay in the diagnosis of acral melanoma. Melanoma Res 1998, 8:181-186. 41. Lemont H, Brady J: Amelanotic Melanoma Masquerading as an Ingrown Toenail....

Ngày tải lên: 10/08/2014, 21:24

... 5 Centre for Primary Care and Population Research, University of Dundee, Dundee, UK, 6 Agenzia Sanitaria e Sociale Regionale, Bologna, Italy, 7 Arthritis Research Campaign National Primary Care ... under- standing. Acknowledgements Preparatory work for this paper was made possible by the award of a grant to EM and CRM of National Institutes for Health Research funding for...

Ngày tải lên: 11/08/2014, 05:21

... strata: theory and practical application. Journal of Clinical Pharmacy and Therapeu- tics 1 A. D 26:121-128. Additional file 1 Candidate factors by change stages. Table lists 33 candidate factors ... Kenjo Y, Antoku Y, Akazawa K, Hanada E, Kinukawa N, Nose Y: An easily customized, random allocation system using the min- imization method for multi-institutional clinical trials. Com...

Ngày tải lên: 11/08/2014, 05:21

... presentation of information in a tabular, rather than descriptive form. Templates are created specif- ically for a particular setting and can be filled in by the reporting physician. Synoptic ... data collection and analysis. All authors read and approved the final manuscript. Additional material Acknowledgements This study has been funded by Cancer Services Innovation Partnership, a...

Ngày tải lên: 11/08/2014, 05:21

... below). Outcomes Mortality was assessed for 7 days after inoculation. Bacter- emia was assessed on days 1 and 4 after inoculation. The distal dorsal tail vein of each unanesthetized pup was cleansed with 70% alcohol ... Northern California vaccine trials and phase IV studies suggest a significant reduction in the frequency of clinically-diagnosed as well as radiologically- Published:...

Ngày tải lên: 11/08/2014, 10:23

... We report a new ultra sensitive real time PCR molecular beacon based assay with remarkable analytical and clinical sensitivity, calibrated against the WHO 1 st International standard. Background Chronic ... current limit of detection of the newer assays is lower than 50 IU/mL with a dynamic range of approxi- mately 8 log 10 [6-13]. Additionally several in-house quantitative assays...

Ngày tải lên: 12/08/2014, 04:20