Fame is a bubble, but not for some Gregory A Petsko pptx

Fame is a bubble, but not for some Gregory A Petsko pptx

Fame is a bubble, but not for some Gregory A Petsko pptx

... seems, can be pretty fleeting. But not for a few, and Crick clearly was one of those. It helped that he was part of a revolution: paradigm shifts have a way of conferring name recognition that lasts ... won that very prize for liquefying helium? My guess is that at least half of the Nobel laureates are not recognizable names to a majority even of scientists in the same bro...
Ngày tải lên : 14/08/2014, 14:21
  • 2
  • 153
  • 0
Blackwell Science, Ltd Group breeding dramatically increases reproductive success of yearling but not older female scrubwrens: a model for cooperatively breeding birds? ppt

Blackwell Science, Ltd Group breeding dramatically increases reproductive success of yearling but not older female scrubwrens: a model for cooperatively breeding birds? ppt

... territory quality (categorical variables), and male age and age squared (continuous variables). Age and age-squared were used in case the effect of male age was not a monotonic increase. There was no effect ... only entail a single season for an individual as a yearling, but could potentially entail multiple years for an ‘older’ female. To avoid repeated measures from older fema...
Ngày tải lên : 14/03/2014, 16:20
  • 16
  • 337
  • 0
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot

Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot

... amylin to evaluate its effect on amylin aggregation. Samples were incubated at 37 °C for 72 h with shaking, and were taken for ThT assays, light scat- tering assays and HPLC analysis at selected ... insulin may be not only a natural inhibi- tor of amylin aggregation, but also a contributor to the amyloid formation and pathogenesis of T2D. We also found that the promotional effects...
Ngày tải lên : 23/03/2014, 04:21
  • 7
  • 388
  • 0
Báo cáo hóa học: " Dual-task costs while walking increase in old age for some, but not for other tasks: an experimental study of healthy young and elderly persons" pdf

Báo cáo hóa học: " Dual-task costs while walking increase in old age for some, but not for other tasks: an experimental study of healthy young and elderly persons" pdf

... avoiding obstacles, engaged in a visual checking task, and/or kept a visual scene in memory. The walking and each non-walking task were administered separately as well as concurrently. For task ... indicators are 20% of the corresponding standard deviation. An age-related deficit of dual-task performance exists where grey bars are larger than black bars. 0 10 20 30 40 walk+spell walk+...
Ngày tải lên : 19/06/2014, 08:20
  • 9
  • 481
  • 0
báo cáo khoa học: " Ornithine-δ-aminotransferase is essential for Arginine Catabolism but not for Proline Biosynthesis" ppsx

báo cáo khoa học: " Ornithine-δ-aminotransferase is essential for Arginine Catabolism but not for Proline Biosynthesis" ppsx

... 5'gtcccatatagttgagccattc for oat1 and oat2; Oat-f2: 5'gctttcatggacgtacattag, Oat-r2: 5'caagtatcaccatgtcaggac for oat3; the T-DNA left border specific primer was 5'ttcggaaccaccatcaaacag. None of ... demonstrating that δOAT-activity is not essential for the normal life cycle of Arabidopsis (data no shown). δOAT is localised in mitochondriaFigure 1 δOAT is local...
Ngày tải lên : 12/08/2014, 05:20
  • 14
  • 463
  • 0
Báo cáo y học: " The formation of cysteine-linked dimers of BST-2/tetherin is important for inhibition of HIV-1 virus release but not for sensitivity to Vpu" potx

Báo cáo y học: " The formation of cysteine-linked dimers of BST-2/tetherin is important for inhibition of HIV-1 virus release but not for sensitivity to Vpu" potx

... HeLa mRNA using the primers 5' ATAAC TCGAG GTGGA ATTCA TGGCA TCTAC TTCGT ATGAC TATTGC and 3' AAGCT TGGTA CCTCA CTGCA GCAGA GCGCT GAGGC CCAGC AGCAC. The resulting PCR product was cleaved ... writing the manu- script. EM performed biochemical and FACS analyses and helped with data analysis. SK assisted with BST-2 muta- genesis and biochemical analyses. KS coordinated and supervised th...
Ngày tải lên : 12/08/2014, 23:22
  • 16
  • 275
  • 0
Báo cáo y học: "Intensive care acquired infection is an independent risk factor for hospital mortality: a prospective cohort study" pot

Báo cáo y học: "Intensive care acquired infection is an independent risk factor for hospital mortality: a prospective cohort study" pot

... a favorable response to antimicrobial therapy. Data registration and statistical analysis Data were collected daily by one of the authors (PY) and entered into an SPSS database (SPSS Data Entry, ... infection on admission in general was not a risk factor for hospital mortality in univariate analysis, community- acquired pneumonia was clearly associated with increased mortality. In an...
Ngày tải lên : 12/08/2014, 23:23
  • 6
  • 259
  • 0
Tài liệu A COMPREHENSIVE QUANTITATIVE MODEL FOR ANALYZING BOND REFUNDING DECISIONS pptx

Tài liệu A COMPREHENSIVE QUANTITATIVE MODEL FOR ANALYZING BOND REFUNDING DECISIONS pptx

... refunding analysis that has not been adequately treated to date is the analysis of a bond refunding proposal with overlapping interest. For example, although Maris [6] included overlapping interest ... replaced by a floating-rate bond, a floating-rate bond replaced by a fixed-rate bond, and a floating-rate bond replaced by another floating-rate bond with a different index or...
Ngày tải lên : 15/02/2014, 13:20
  • 9
  • 357
  • 1
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx

The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx

... liver biochemistries (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, albumin levels and prothrombin ... each individual case. {Includes the normal laboratory values for boys and girls for the age range of our patient population. {Based on percentile for age and sex. ALT, alanine aminot...
Ngày tải lên : 22/03/2014, 10:20
  • 7
  • 487
  • 0
Từ khóa: