Báo cáo sinh học: " Factors inﬂuencing the eﬃciency of a marker-assisted introgression programme in Merino sheep" ppt

... pro-grammes in the case of a situation concerning sheep breeding. This study in- vestigated two factors and their interactions that in uence the backcross gen-eration of an MAI breeding programme and therefore ... measure. The factor causing the most in uence on the diﬀerent backcrossing strate-gies in the MAI breeding programme was the availability of genetically su-perior animals for the backcrossing ... cover the additional cost of genotyping. In marker-assisted introgression, reciprocal crossing of male and female selection candidatesfrom the backcross and the purebred line was the most advantageous...

Báo cáo sinh học: "Probability statements about the transmitting ability of progeny-tested sires for an all-or-none trait with an application to twinning in cattle" pptx

... than the beta binomial. In particular, it can be easily adaptedto mixed model structures involving a multipopulation analysis as well as severalrandom sources of variation. ... binary (pb) and underlying (p) scales in a population in which the incidence of the trait is 7r,, (see next paragraph). In the case of twinning, interest is usually ... class="bi x0 y0 w0 h 0" alt ="" Original articleProbability statements about the transmittingability of progeny-tested sires for an all-or-nonetrait with an application to twinning...

... 6: The graph of micro-average F -measureagainst the number of training sentences duringtext chunking (A: MHHMM, B: HHMM and C:HMM) The ﬁrst ﬁnding is that the size of training datadramatically ... rolestypically has poor accuracy. In the text chunk-ing task the number of observation symbol relieson the number of part -of- speech tags contained in training data. Figure 6 plots the relationship of micro-average ... more accu-rate results either a plain HHMM or a HMM dur-ing the text chunking task. The results suggestthat the partial ﬂattening process is capable of im-proving model accuracy when the input...

báo cáo sinh học:" Measuring and managing the work environment of the mid-level provider – the neglected human resource" pdf

... Mozam-bique, Tanzania, Uganda and Zambia have such cadreswho are doing essential medical tasks, especially in ruralareas [8]. In Malawi, clinical officers are a major resource of the health sector; they ... in the literature review, study design,data collection and analysis. FM participated in the datacollection, data cleaning and preliminary analysis. MMand DH conducted the data analysis and ... to abolish the enrolled nursing programme in the early1990s and instead to focus on training registered nurses.Training of enrolled and auxiliary nurses was also stopped in Ghana and Zambia....

Báo cáo sinh học: " Epidemics to eradication: the modern history of poliomyelitis" docx

... [3,113,144,147] as well as in reg-ulating the initiation of translation; and (ii) the IRES[197], which mediates cap-independent translation of the viral mRNA by facilitating initiation of translation inde-pendent ... [184-186].U A A A AC A GCUCUGGGGUUGUU A ACCCCAGAGCCCGCCCC A GGCGUGGC A UUUUGUCCGUAGUACCAUGCUCUUUGGUACCAUUUGGGCUUCCCUACUUCAAUGCCCCACGCAAGUAACCAAAAGUUC A G A U A G A AGGGU A C A AC A UGAC A CC A AGC A C A CCACAGAUUGUCUUUCCGCGGCU A UGUCGU A AUG A CUGCUUGCUUGGUG A G A AGC A GCGUUGCCAUGCCUAUU A UGU A CCUG A G A CCC A GU A CCCCUCG A G A AUCUUCGU A UGCUUGGCUG A AUG A UCUGGG A C A UCCCUGUG A GUGGCC A CCGUGG A CCCUGGCGUUGG A GCGGCUCGC A GCGUGCCAUGGGCC ... protein folding resulting in masking of cer-tain cleavage sites and by amino acid sequences adjoining the scissile bond [78] The first cleavage of the genomicpolyprotein at a tyrosine-glycine...

Báo cáo sinh học: " Genetic lesions within the 3a gene of SARS-CoV" ppt

... relationshipbetween the mutations observed in the 3a transcripts and the severity of the clinical symptoms in individualpatients.Competing interests The author(s) declare that they have no competinginterests.Authors' ... mutations in the viral genome, can be incorporated in the virion and ifthere are phenotypic effects of a truncated 3a during the infection cycle. With respect to viral viability in the naturalhost, ... viral RNA from clinicalsamples obtained from SARS-CoV infected patients also contains a heterogeneous population of wild-type and mutant 3a transcripts.FindingsIntroductionNumerous isolates...

báo cáo hóa học:" Factors associated with "Ikigai" among members of a public temporary employment agency for seniors (Silver Human Resources Centre) in Japan; gender differences" ppt

... concept anddesign, acquisition of data, analysis and interpretation of data, and drafting of the manuscript. Hiroyasu Iso partic-ipated in analysis and interpretation of data, and the helpfor drafting ... drafting of the manuscript, and provided statisticalexpertise. Hideki Fukuda participated in the study conceptand design, acquisition of data, analysis of data and inter-pretation of data, and ... data and the help forcritical revision of the manuscript. Kozo Tatara partici-pated in the study concept and design, acquisition of data,interpretation of data, and the help for critical revision...

Báo cáo sinh học: "Wnt signaling and the developmental fate of lung cells" ppsx

... says.Accordingly, Hogan has adopted the term ‘transdetermination’, coinedoriginally to describe the behavior of regenerating cells of the imaginal disc in Drosophila larvae, rather than‘transdifferentiation’, ... gene-expression profilingusing microarrays revealed the activity of genes that are normally expressedonly in intestinal epithelial cells. “We nearly fell off our chairs whenwe saw all these intestinal genescoming ... homolog Wingless or Vestigial is misexpressed in them. of local injury and inflammation thereis local up-regulation of Wnt signalingand the activity of ␤-catenin, and thatthis is then switching...

Báo cáo sinh học: " Hide and seek: the secret identity of the phosphatidylserine receptor" pps

... Miwa K, Shinohara A, Iwamatsu A, NagataS: Identification of a factor that links apoptotic cells tophagocytes. Nature 2002, 417:182-187.9. Shiratsuchi A, Kawasaki Y, Ikemoto M, Arai H, Nakanishi ... question wasexamined in more detail in a later paper from the same lab-oratory [12], where an experimental system was establishedthat allowed the binding step of the uptake of an apoptoticcell ... proteins that correspondto the PS receptor, the aminophospholipid translocase (APLT), and the scramblase are unknown, as are the functions of ABCA1 and the PSexposed on the surface of the phagocyte....

Báo cáo sinh học: "X-chromosome inactivation: the molecular basis of silencing" ppt

... 2c).Does the change in Xist DNA methylation in pre-X-chromosome-inactivation cells affect the fate of the Xchromosomes after inactivation is initiated? To answer thisquestion Nesterova et al. analyzed ... coat the whole X chromosome. In the first issue of Epigenetics and Chromatin, Nesterova and colleagues investigate the role of the RNA interference pathway enzyme Dicer in DNA methylation of ... University of California, San Francisco, CA 94158, USA. Email: bpanning@biochem.ucsf.eduX-chromosome inactivation is the transcriptional silencing of one X chromosome in female mammalian cells thatequalizes...

Xem thêm

Từ khóa: báo cáo khoa học sinh học trạng thái hiện sinh báo cáo khoa học báo cáo sinh thái học báo cáo trường học thân thiện học sinh tích cực báo cáo sinh học phân tử chuyên đề điện xoay chiều theo dạng Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM