Báo cáo sinh học: " Estimating the frequency of Asian cytochrome B haplotypes in standard European and local Spanish pig breeds" doc
báo cáo sinh học:" Assessing the impact of a new health sector pay system upon NHS staff in England" pot
... pre-existing system capable of evaluating all of the jobs covered. The new pay spines are divided into nine pay bands, and staff covered by Agenda for Change were assimilated on toone of these pay bands ... difficult to assess impact andvariations in impact across the NHS. While the pay system implemented in the NHS wasdesigned for the characteristics of that health care organi-zation, there are some ... higher pay andprices – mainly pay increases under Agenda for Changeand for medical staff. The implementation costs for the new pay system have been calculated as a cumulativeadditional cost of...
- 7
- 453
- 0
báo cáo sinh học:" Doubling the number of health graduates in Zambia: estimating feasibility and costs" pdf
... management of training institutions.Outside of the MoH, the Cabinet Office and the Minis-try of Finance control the annual budget for all minis-tries. The Ministry of Education and the Ministry of Science, ... crisis, the MoH plans to double the annual number of health training graduates in the next five years to increase the supply of health workers. The feasibility and costs of achieving this initiative, ... usedabottom-upapproachtoassess the costs and feasibility of doubling graduates ateach of the 39 public and private health training institu-tions in Zambia, which run a total of 72 health degree,diploma, and certificate...
- 9
- 609
- 0
báo cáo sinh học:" Reviewing The Benefits of Health Workforce Stability James Buchan" doc
... 8:29http://www.human-resources -health. com/content/8/1/29Page 4 of 5 REVIEW Open Access Reviewing The Benefits of Health Workforce Stability James BuchanAbstractThis paper examines the issue of workforce stability and turnover in the conte xt of policy ... of workforce stability andmethods of monitoring it. The objective of the paper istherefore to contribute to developing a better under-standing of workforce stability as a major aspect of the overall ... The objective of the paper is to contribute to developing a better understanding of workforce stability as a major aspect of the overall policy goal of improved retention of health workers. The...
- 5
- 351
- 0
báo cáo sinh học:" Improving the implementation of health workforce policies through governance: a review of case studies" pdf
... 9:10http://www.human-resources -health. com/content/9/1/10Page 8 of 10 REVIEW Open Access Improving the implementation of health workforce policies through governance: a review of case studiesMarjolein Dieleman1*, Daniel MP Shaw2†and Prisca Zwanikken1†AbstractIntroduction: ... analysis The authors of this article constituted the researchteam, and were assisted by a librarian to search forabstracts. The initi al search for articles was done by the librarian; all abstracts ... vision of a fairer South Africa wasbehind the motivations for the development and imple-mentation of the M ental Health Care Act 2002 [18]; and the bold leadership of two major stakeholders wasenough...
- 10
- 546
- 0
báo cáo sinh học:" Towards the construction of health workforce metrics for Latin America and the Caribbean" pot
... Moliné5 and Sabado S Girardi6AbstractIntroduction: One of the components of the Health Observatory for Latin American and the Caribbean (HO-LAC)is the design and implementation of metrics for ... et al.: Towards the construction of health workforce metrics for Latin America and the Caribbean. HumanResources for Health 2011 9:24.Submit your next manuscript to BioMed Central and take ... salud; and in English: health workforce, humanresources for health, availability of human resources for health, metrics for human resources for health, situa-tional analysis of human resources for...
- 9
- 481
- 0
Báo cáo sinh học: " A pandemic strain of calicivirus threatens rabbit industries in the Americas" pdf
... from China, and phylogenetic analysis of the major capsid protein (VP60) revealedthat they were related to a pandemic antigenic variant strain known as RHDVa. Rapid spread of the RHDVa pandemic ... JournalOpen AccessResearch A pandemic strain of calicivirus threatens rabbit industries in the AmericasMichael T McIntosh*1, Shawn C Behan1, Fawzi M Mohamed1, Zhiqiang Lu2, Karen ... primer:GGCCACGCGTCGACTAGTAC and a conserved forwardprimer 3PForRHD: AGTGTTAAGATTTATAATACC. The 5'end of UT-01, NY-01, IN- 05, and ITALY-90 were obtainedby the 5' RACE. Random primed cDNA was tailed...
- 13
- 639
- 0
báo cáo hóa học:" Estimating the cost of care giving on caregivers for people living with HIV and AIDS in Botswana: a cross-sectional study" doc
... Ama and Seloilwe, Estimating the cost of care giving on caregivers for people living with HIV and AIDS in Botswana: a cross-sectional study Journal of the International AIDS Society 2010, 13:14Received: ... Population Council; 2005. 30. Phaladze NA: The impact of Care giving on Caregivers: Taking care of caregivers. Pre-6th HCC 2003.31. Chella A: Reducing the Burden of HIV and AIDS Care on Women and ... caregivers in informal care and todetermine the direct non-medical costs the caregivers incur in providing care to PLHIV. These costs were exam-ined within the context of: increased cost of living; decreased...
- 8
- 384
- 0
Báo cáo sinh học: "Untangling the web of functional and physical interactions in yeast" pdf
... probabilistic model of genetic and physical inter-actions that allows prediction of new protein functions and genetic interactions in addition to studying the organiza-tional principles of the integrated ... between-pathwayinterpretation of a dense bundle of genetic interactions. On the other hand, the network theme in which components of the same complex have genetic interactions with each othercorresponds ... (e)(f) MinireviewUntangling the web of functional and physical interactions in yeastMarkus J Herrgård and Bernhard Ø PalssonAddress: Department of Bioengineering, University of California, San Diego,...
- 4
- 365
- 0
Báo cáo sinh học : "Exploiting the promiscuity of imatinib" pdf
... structure of imatinib bound to the oxidoreductase NQO2 and reveals insightsinto the binding specificity and the off-target effects of the inhibitor.Journal of Biology 2009, 8 8:: 30Published: 15 ... (CML), in which the chronic phase of the disease is characterized by the increasedproliferation of the myeloid lineage and which iscytogenetically diagnosed by the presence of the Philadelphiachromosome. ... effective for the treatment of type 1diabetes, largely through inhibition of PDGFR. Given the involvement of NQO2 in oxidative stress, it will be of interest to determine whether the inhibition of thisoxidoreductase...
- 4
- 286
- 0
Báo cáo sinh học: " Generalizing the use of the canonical transformation for the solution of multivariate mixed model equations" doc
... solve the univariate systems:DIFFERENT MODELS FOR DIFFERENT TRAITSA third requirement for the applicability of the canonical transformation is the use of the same model for ... prediction of the missing ones at the currentEM iteration, transformed records on the canonical scale can be computed. After solution of the mixed model equations on the canonical ... strategy, the solutions of the batch and animal effectsare obtained through a regular canonical decomposition and the solution of the operator effect fQ on the transformed...
- 20
- 311
- 0
Báo cáo sinh học: "On the relevance of three genetic models for the description of genetic variance in small populations undergoing selection" docx
... the higher the decrease in genetic variance. This comparison of the Original articleOn the relevance of three genetic models for the description of genetic variance in ... intrinsically takes account of the reduction in selection intensity as compared with the theory, of the relationships betweenmates and inbreeding induced in the offspring ... the hypothesis of infinitenumber of alleles per locus. Results of FFM presented later, where the effect of the number of loci decreases when increasing the number of...
- 12
- 279
- 0
Báo cáo y học: " Estimating the impact of expanded access to antiretroviral therapy on maternal, paternal and double orphans in sub-Saharan Africa, 2009-2020" ppt
... al.: Estimating the impact of expanded access to antiretroviral therapy on maternal, paternal and double orphans in sub-Saharan Africa, 2009-2020. AIDS Research and Therapy 2011 8:13.Submit your ... tion model may have also over-estimated the number of orphans in curred and averted in the sub-Saharan African countries under study.This study only indirectly considered the impact of non-adherence ... contributionsAA conceived the study design, contributed to the demographic modelingmethods, and wrote the first draft of the manuscript. CA and MJ ran the demographic projection software and...
- 8
- 490
- 0
Báo cáo sinh học: "Finding the region of pseudo-periodic tandem repeats in biological sequences" potx
... similar.Example: The example is from [1]. The sequence of the LbH domain of members of the LpxA family consists of the imperfect tandem repetition of hexapeptide units [9-11]. These imperfect tandem repeats ... give a definition of the pseudo-peri-odic partition of a string that is originally proposed in Li etal. [1]. We then give a definition of the local pseudo-periodic partition of a string. Pseudo-periodic ... string s, find a substring t (the local optimal pseudo-periodic region) of s such thatwhere Sub(s) is the subset of all substrings of s. The algorithmLet s be the given string. We want to find...
- 8
- 247
- 0
Báo cáo sinh học: "On the optimality of the neighbor-joining algorithm" ppsx
... polytope are the BME vectors of binarytrees. The BME vector of the star phylogeny lies in the interior of the BME polytope, and all other BME vectors lie on the boundary of the BME polytope. The normal ... union is all of of , and the intersection of any twocones is a subset – but not necessarily a face – of the boundary of each of the cones. Given an input from the interior of Cσ, the NJ algorithm ... mean the pointed portion of the cone, i.e. modulo the lineality space.Theorem 4.1 The cones in do not form a fan. In particular, they are not the normal fan of any polytope for n ≥ 5. The theorem...
- 11
- 354
- 0
Báo cáo sinh học: " Estimating the frequency of Asian cytochrome B haplotypes in standard European and local Spanish pig breeds" doc
... first time the < /b> prevalence of < /b> cytB haplotypes in the < /b> BPI and GPI breeds. The < /b> BPI breed originated around the < /b> small vil-lage of < /b> Pi´etrain in Belgium in 1920, but its ancestry still remains obscure ... probably brought by the < /b> Phoenician colonisers being mixed with otherswine breeds due to the < /b> invasion of < /b> the < /b> Balearic Islands by the < /b> Romans, and the < /b> Catalans [4, 9]. The < /b> small effective size of < /b> ... are distinctive of < /b> the < /b> Chinese breeds.Taken together, our results demonstrate that Asian < /b> haplotypes are ubiquitouslydistributed in most of < /b> the < /b> standard European pig breeds but not in local popu-lations...
- 8
- 217
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ