Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot

báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx

... some projects, mainly in the medicine specialty of the medical sector (8.9%) Although QAAP is one of the six projects of the HEEP, 8.9% of the medical sector projects of the HEEPF addressed the ... Central Page 1 of 8 (page number not for citation purposes) Human Resources for Health Open Access Review Review of the utilization of HEEPF...

Ngày tải lên: 18/06/2014, 17:20

8 697 0
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot

... managed the VCT training program from the Caribbean; and to Barbara McGaw (The Caribbean HIV/ AIDS Regional Training network [CHART], Kingston, Jamaica), who oversaw the VCT training program. ... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Bar- buda, Dominica, Grenada, and Turks & Caicos in 2005. Cl...

Ngày tải lên: 18/06/2014, 17:20

8 450 0
Báo cáo sinh học: " Clearance of an immunosuppressive virus from the CNS coincides with immune reanimation and diversification" pptx

Báo cáo sinh học: " Clearance of an immunosuppressive virus from the CNS coincides with immune reanimation and diversification" pptx

... Central Page 1 of 16 (page number not for citation purposes) Virology Journal Open Access Research Clearance of an immunosuppressive virus from the CNS coincides with immune reanimation and diversification Henning ... adaptive immune repertoire, which includes the mobilization of CD4 + T cells and B cells, is responsible for the eventual clearance of...

Ngày tải lên: 18/06/2014, 18:20

16 378 0
Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx

Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx

... immunological course of acute hepatitis C in asymptomatic patients with spontaneous clearance: patients with spontaneous clearance in the absence of anti -HCV. HCV- RNA levels, ALT levels and T cell ... the immunopathogenesis of HCV- infection and maybe an explanation for the rather low seroconversion rate after occupational exposure to HCV. The data should als...

Ngày tải lên: 18/06/2014, 18:20

11 528 0
Báo cáo sinh học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx

Báo cáo sinh học: " Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix" docx

... 1 of 5 (page number not for citation purposes) Virology Journal Open Access Research Regulation of HTLV-1 Gag budding by Vps4A, Vps4B, and AIP1/Alix Shuzo Urata 1,2,3 , Hideyoshi Yokosawa 3 and ... mechanism of HTLV-1 budding in detail, we analyzed HTLV-1 budding using dominant negative (DN) forms of the class E proteins. Results: Here, we report that DN for...

Ngày tải lên: 18/06/2014, 18:20

5 303 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... Gaps introduced during alignment are indicated by a dot. A 63  TTCACGCAGAAAGCGTCTAGCCAT...

Ngày tải lên: 18/06/2014, 18:20

12 354 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

... R5- TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT- GGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATT- GCTATGATTAGTGCTA CTATCAATGCTCCTACTC- CTAATTTATAATCTAAATTTAACATCTC. ... GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu- R5-F, GGATCCATGTTAAATTTA- GATTATAAATTAGGAGTA GG and Vpu- R5-R, GAAT- TCATTACAAATCATTAA...

Ngày tải lên: 18/06/2014, 18:20

11 436 0
Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

Báo cáo sinh học: " Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland" pdf

... Access Research Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland John F Menton*, Karen Kearney and John G Morgan Address: ... hospitals. Results: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on...

Ngày tải lên: 18/06/2014, 18:20

8 535 1
Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

Báo cáo sinh học: " Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse" pdf

... Hirabayashi Y, Kikuta K, Suzuki Y, Nagamine T, Aizawa C, Nakagawa M, Kurata T: Functional role of respiratory tract haemagglutinin-specific IgA antibodies in protection against influenza. Vaccine ... Hagiwara Y, Chen Z, Kadowaki SE, Tsujimoto H, Kurata T, Tamura SI: Induction of innate immunity by nasal influenza vaccine administered in combination with an adjuvant (chole...

Ngày tải lên: 18/06/2014, 18:20

14 516 0
Báo cáo sinh học: " Evolution of temperate pathogens: the bacteriophage/bacteria paradigm" potx

Báo cáo sinh học: " Evolution of temperate pathogens: the bacteriophage/bacteria paradigm" potx

... an analogy to the extended biological role of the MHC (or HLA) part of the vertebrate immune system. Some of the disadvantages of several of the large number of extant alleles of the MHC system ... both the CI and rII proteins are inhibitory to the genome of the cell that created them, but they aid the host population by either inhibiting the growth of...

Ngày tải lên: 18/06/2014, 18:20

9 490 0
Báo cáo sinh học: " Generation of high-titer viral preparations by concentration using successive rounds of ultracentrifugation" doc

Báo cáo sinh học: " Generation of high-titer viral preparations by concentration using successive rounds of ultracentrifugation" doc

... Access Generation of high-titer viral preparations by concentration using successive rounds of ultracentrifugation Christine V Ichim 1,2 and Richard A Wells 1,2,3,4* Abstract Background: Viral ... 7:910-913. doi:10.1186/1479-5876-9-137 Cite this article as: Ichim and Wells: Generation of high-titer viral preparations by concentration using successive...

Ngày tải lên: 18/06/2014, 22:20

8 303 0
Báo cáo sinh học: " Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein" doc

Báo cáo sinh học: " Inhibition of Henipavirus fusion and infection by heptad-derived peptides of the Nipah virus fusion glycoprotein" doc

... membrane fusion. Peptides Inhibition of Hendra virus and Nipah virus infection by N-terminal and C-terminal pegylated heptad peptidesFigure 6 Inhibition of Hendra virus and Nipah virus infection by ... availability of NiV in the Inhibition of Hendra virus and Nipah virus infection by capped heptad peptidesFigure 5 Inhibition of Hend...

Ngày tải lên: 19/06/2014, 08:20

15 387 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt

Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt

... who practiced either a ballistic or a ramp pinch task, an increase in force and acceleration, asso- ciated with an increase in MEP amplitude, was observed in the muscle involved in the training, ... 3 of 8 RESEARC H Open Access Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonis...

Ngày tải lên: 19/06/2014, 08:20

8 432 0
Báo cáo sinh học: " Precision of methods for calculating identity-by-descent matrices using multiple mar" pot

Báo cáo sinh học: " Precision of methods for calculating identity-by-descent matrices using multiple mar" pot

... 15 cM. 2.5. Index for information from the markers An information index was presented in order to provide some understanding of the precision of the methods for calculating IBD matrices. It considers ... results of a comparison of a deterministic method and an MCMC based method for calculating IBD matrices for a number of scenarios of population structure, densi...

Ngày tải lên: 14/08/2014, 13:21

23 206 0
Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot

Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot

... of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene Solange S OULIER a , Marthe ... using the BAC DNA as the template and oligos 5  GGTCGACTTATATATTTATGAACACATTTA 3  and 5  CCCGGGATAACTTCGTATAATGTATGCTATACGAACGGTATCCT-...

Ngày tải lên: 14/08/2014, 13:22

9 359 0
Từ khóa:
w