Báo cáo sinh học: " A mutation in the MATP gene causes the cream coat colour in the horse" pot

... 129 ● ●● ● Cr ATGGGTGGCAACAGTGGGCAGCCTGGCGTTCCCACCTATAAGTCCCTAGCTGAGGATGGCCCCTTTGGCTCCGTGGAGC ATGGGTGGCAACAGTGGGCAGCCTGGCGTTCCCACCTATAAGTCCCTAGCTGAGGATGGCCCCTTTGGCTCCGTGGAGC ATGAGTGGAAGCAATGGGCCGACTGACACCCATACCTATCAATCCTTAGCCGAGGATTGCCCCTTTGGCTCTGTGGAGC ATGGGTAGCAACAGTGGGCAGGCTGGCCGCCACATCTATAAATCCCTAGCTGATGATGGCCCCTTTGACTCTGTGGAGC Cr GCCCAAAAGATCCACGGGCAGGCTCGTCATGCACAGCATGGCCATGTTCGGCCGGGAA...

Ngày tải lên: 14/08/2014, 13:21

... laboratory (Laboratoire d’anatomie pathologique vétérinaire, Amboise, France). The skin was fixed in formalin and then embedded in paraffin. The sections were cut and either stained with eosin and ... cytosine provokes a frameshift in the open reading frame and generates a premature termination codon. The truncated γ2 subunit lacks its C-terminal domain that mediates the int...

Ngày tải lên: 14/08/2014, 13:22

... strategic planning approach. Assess and align mission The newly created Department of Health Behavior and Administration was charged with administering two exist- ing graduate degree programmes ... potential leader in establishing a thriv- ing research base that emphasized population health and health behaviour research while generating responsive and progressive health and human servic...

Ngày tải lên: 18/06/2014, 17:20

... the relative segregation of paternal fragments in their progeny, the other considers that, in the same animal, any fragment should not triplicate with others already assigned ... allocated to any specific other loci mainly because insufficient genetic information could be obtained (bands A, G, J, K and L). Mutation rate in allele length...

Ngày tải lên: 14/08/2014, 19:22

... Kukasha W, Ahoua L, Le Paih M, Munger A, Kabwinja A, Mpunga J, Chazel E, Jeannin A, Szumilin E, Kamoto K, Harries A: Nurses and medical assistants taking charge: task-shifting HIV care and HAART ... operating costs, or increase patient load for the same cost. A study comparing total average annual clinic-level cost per ART patient in Uganda and South Africa found that mean costs w...

Ngày tải lên: 18/06/2014, 17:20

... covers all matchings that can be decomposed into two non-crossing matchings in the interval i k, and the interval k + 1 j. In the case of Rule d, the matching is called a bipartition,andtheinterval i ... straight lines cross. Finally, a permitted matching M is a matching that is non-crossing, where each match in M is a permitted match. The basic RNA-folding problem is...

Ngày tải lên: 12/08/2014, 17:20

... indicate that as the source increases the destination also increases. The dotted lines notated as indicate that an increase at the source decreases the destination. For example, an increase in the ... other governance mechanisms (including managers and administrators), can be consid- ered as other individual 'players' in the contest. Clinical care microsystems Th...

Ngày tải lên: 18/06/2014, 17:20

... sum of the appropriate genetic distances. The position was standardised by placing one population to the coordinate origin and rotating the 2DI to set the second one on the diagonal in quadrant ... (Perkin Elmer) using an internal TAMRA-labelled standard. For each run, internal and external standards were used to determine allele lengths. External standards corresponded to sampl...

Ngày tải lên: 14/08/2014, 13:22

... local use. Training on HIV/AIDS pharmaceutical management In Uganda and Tanzania the RTRC has been actively par- ticipating in the training of health care workers in HIV/ AIDS pharmaceutical management. ... countries. In Tanzania and Uganda the RTRC has been involved with the training of health care workers in HIV/AIDS pharmaceutical management. In Kenya, Tanzania and Ugan...

Ngày tải lên: 18/06/2014, 17:20

... acquired the data. HRR analyzed the data and all three authors interpreted the data, wrote the manuscript, and approved the final version. Competing interests The authors declare that they have no ... by a grant from the American Medical Association Women Physicians Congress through the Joan F. Giambalvo Memorial Scholarship, to aid in data acquisition, survey printing and...

Ngày tải lên: 18/06/2014, 17:20