Báo cáo sinh học: "Results of a whole genome scan targeting QTL for growth and carcass traits in a Piétrain × Large White intercross" potx
Báo cáo sinh học: "Results of a whole genome scan targeting QTL for growth and carcass traits in a Piétrain × Large White intercross" potx
... article Results of a whole genome scan targeting QTL for growth and carcass traits in a Piétrain × Large White intercross Carine N EZER , Laurence M OREAU , Danny W AGENAAR , Michel G EORGES ∗ Department of ... herein report the results of a whole genome scan performed in a Piétrain × Large White intercross to map QTL in uenci...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo khóa học: Disruption of the interaction between the Rieske iron–sulfur protein and cytochrome b in the yeast bc1 complex owing to a human disease-associated mutation within cytochrome b potx
... glutamate (in yeast or humans) may affect the structure of the hinge region, resulting in a hindered move- ment and enzyme instability. As suggested previously for a yeast mutant with a +1 alanine ... mitochondrial membrane preparations (data not shown). This could be a result of the instability of the mutant enzyme and an increased sensitivity to degradation during mem...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo sinh học: " Convergence of the modified Mann''''s iterative method for asymptotically kappa-strictly pseudocontractive mappings" pptx
... pseudocontractive mappings; demiclosedness prin- ciple; the modified Mann’s algorithm; fixed points. 1 Introduction Let E and E ∗ be a real Banach space and the dual space of E, respectively. Let K be a nonempty ... asymptotically κ-strictly pseudocontractive mappings and the class of κ-strictly pseudocontractive mappings are independent. A mapping T is said to be uniformly L-Li...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx
... 2304 T2S59 GCGUGA UCCGUGACAUGCGUAGUAUGACACCUGCCCCCAGGUCAAAGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T3C12 GCGUGA UCCGUGACAUGCGUAGUGUGACACCUGCUCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T3C18 ... 2304 T1L GCGUGA UCCGUGACAUGCGUAGUGUGACACCUGCCCCUAGGUCAAUGGGGGUAGGGGGCGGGCUAAGACUACGUACGCGCUUCAUC 2304 T2J GCGUGAGUCGGGUCAUGCAACGUCGAACACCUGCCCCAUGGUCAAUGGGGGUAGGGG CGGGCUAAGACUACGUAC...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Typing of human rotaviruses: Nucleotide mismatches between the VP7 gene and primer are associated with genotyping failure" pdf
... strains. The G1 rotavirus VP7 gene specific primers were described by Das et al. [2] and Gouvea et al. [6]. Mismatches are in red. TCTTGTCAAAGCAAATAATA 3’ 5’ Das primer, 9T1-1 CAAGTACTCAAATCAATGATGG 5’ 3’ Gouvea ... 9T1-1 CAAGTACTCAAATCAATGATGG 5’ 3’ Gouvea primer, aBT1 Target sequence Target sequence CAAGTACTCAAATCAGTGATGG TTTAGTTAAGGCAAATAATA BioMed Central Page 1 of 5 (page number n...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Inhibition of NF-κB activation by 5-lipoxygenase inhibitors protects brain against injury in a rat model of focal cerebral ischemia" docx
... 5'-ggaggaatgggagtt- gctgttgaa-3'; iNOS, forward primer, 5'- ggaagaggaacaactactgctggt-3', reverse primer, 5'-gaactgaggg- tacatgctggagc-3'. Thermal cycling conditions were as ... Access Research Inhibition of NF-κB activation by 5-lipoxygenase inhibitors protects brain against injury in a rat model of focal cerebral ischemia Manu Jatana 1 , Shailendra Giri...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo sinh học: " Prediction of breeding values with additive animal models for crosses from 2 populations" ppt
... offspring of 5 and 6, the latter being an Fl dam with unknown parents. Individuals 1, 4 and 5 are males and the rest are females. Age at measure and observed data for ... specification of the variance- covariance matrix for additive and dominance effects in crosses of 2 populations can involve as many as 25 parameters for a...
Ngày tải lên: 09/08/2014, 18:22
Báo cáo y học: "Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case repor" ppt
... and usual rapid and dramatic improvement of the symptoms [6]. Other drugs, such as opioids (methadone, hydrocodone), GABA analogue (gabapentin, pregabalin), and ben zodia- zepi nes (clonazepam) ... of this treatment. Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent...
Ngày tải lên: 11/08/2014, 03:21
Báo cáo y học: " Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case report" docx
... but there are other similar devices available for healthcare providers. Anodyne is FDA approved for incr easing cir- culation and reducing pain, and it has been successf ully used in wound management ... the treatment of RLS. Now ropinirole and pramipexole, both dopamine ago- nists, are available . Unfortunately these drugs can cause insomnia, nausea, dyspepsia, and dizziness...
Ngày tải lên: 11/08/2014, 07:20
Báo cáo y học: "Effects of monoclonal anti-PcrV antibody on Pseudomonas aeruginosa-induced acute lung injury in a rat model" ppt
... study, and partici- pated in its design and coordination. All authors read and approved the final manuscript. Abbreviations P. aeruginosa:Pseudomonas aeruginosa, IT: Intratracheal administration Acknowledgements This ... had the same therapeutic potency as the whole IgG and the therapeutic administration of Fab fragments may overcome the disad- vantages of the intratracheal ad...
Ngày tải lên: 11/08/2014, 10:23