... of 50 % RH G 02 A0 10 0% RH G 01 G 09 G 06 G 05 G 07 G 03 G 08 G 04 G 28 G 14 G 22 G 29 G 12 G 23 D 3E G 27 G 36 G 30 G 37 G 24 G 13 DD 2I DD 3F DD 3H DD 3G G 18 DD 2J G 26 G 38 G 35 G 19 G 15 G 20 G 25 G 21 G 31 G 34 DD 3D G 16 G 17 DD 2E DD 2D G 10 G 11 M 10 M 11 M 02 A1 A2 A1 A1 G 33 DD 2A A1 AAGAGGAAAGCCCGGAAGAAGGGAG G A •••••••••••GG•••••AC•...
Ngày tải lên: 14/08/2014, 13:21
... KL, Garcia-Sastre A, Ball LA, Palese P, Ding SW: Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proc Natl Acad Sci U S A 2004, 10 1 (5) :13 50 -13 55 . 5. ... Lys at position 52 and Arg at position 54 or 55 (Lys-Xaa-Arg or Lys-Xaa- Xaa-Arg) are conserved among all except PSLV. Gly at position 77 is conserved among all except to...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Mapping of quantitative trait loci for flesh colour and growth traits in Atlantic salmon (Salmo salar)" ppt
... [18 ]. Marker grouping and initial marker ordering was done with Joinmap 3.0 [19 ]. A Joinmap input file was made for each mapping parent (in double haploid format), containing information on alleles inherited ... AE, Taggart JB, Derayat A, McAndrew BJ, Haley CS: Detection of QTL affecting harvest traits in a commercial Atlantic salmon population. Anim Genet 2009, 40: 753 - 755 ....
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: " Detection of multiple QTL with epistatic effects under a mixed inheritance model in an outbred population" pot
... population. exactly half of the total number of individuals, then the number of the indi- viduals in the F 2 generation fluctuates slightly from 600. Details are shown in Figure 1. The number of alleles ... com- plicated mechanism of quantitative traits, conventional methods considering only one QTL at a time, such as interval mapping [13 ] and composite inter- val...
Ngày tải lên: 14/08/2014, 13:22
Báo cáo sinh học: " Performance of AAV8 vectors expressing human factor IX from a hepatic-selective promoter following intravenous injection into rats" ppt
... liver after intrave- nous administration of scAAV8-LP1-hFIX at doses of 1 × 10 11 and 5 × 10 11 vg/rat showed expression of hFIX in the hepatocytes at 16 weeks that was substantially higher than hFIX ... gene therapy targeted at skeletal and cardiac muscle, again via intravascular injection. It is important to assess vector targeting at the level of virion accumulat...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo khoa học: Overexpression of human histone methylase MLL1 upon exposure to a food contaminant mycotoxin, deoxynivalenol docx
... CGATTTTCTGGGACTCG Rbbp5 GCATCCATTTCCAGTGGAGT TGGTGACATCCACTTCCTCA Ash2 CCTGAAGCAGACTCCCCATA AGCCCATGTCACTCATAGGG HoxA7 TTCCACTTCAACCGCTACCT TTCATACATCGTCCTCCTCGT Sp1 TCATACCAGGTGCAAACCAA GCTGGGAGTCAAGGTAGCTG MLL1 ... Forward primer (5 -to3 ¢ ) Reverse primer (5 -to3 ¢) b-actin AGAGCTACGAGCTGCCTGAC GTACTTGCGCTCAGGAGGAG MLL1 GAGGACCCCGGATTAAACAT GGAGCAAGAGGTTCAGCATC Set1 CTGACGAGATGGTCATCGAA CG...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo y học: " Isolation of suppressor genes that restore retrovirus susceptibility to a virus-resistant cell line" potx
... (sequences: 5& apos;- ATATAGCTTAAGGCCACCATGGCAGACGATATTGATAT- 3' and 5& apos;-ATATAGGCGGCCGCTCATCGTCTACTT- GGAAC-3'), and cloned into the pcDNA3 .1/ zeo expres- sion plasmid using AflII and NotI ... cell line A1 A2 B1 B2 C1 C2 Total cDNAs examined 50 50 50 50 50 - 250 Distinct cDNAs 10 2 5 1 11 0 29 Active cDNAs 0 0 1 0 1 0 2 Retrovirology 2004, 1: 30 http://...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo sinh học: "Development of avian influenza virus H5 DNA vaccine and MDP-1 gene of Mycobacterium bovis as genetic adjuvant" pptx
... were read on a plate reader apparatus and statistically analyzed using repeated measure ANOVA. The sequence analysis of the H5 of the H5N2 showed more than 87% similar with the H5 of H5N1 in use (data ... potential of DNA vaccines as an alternative to inactivated vaccines [12 ,13 ]. Recently, we have showed that the fusion of ESAT-6 of Mycobacterium tuberculosis...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: "Mapping quantitative trait loci (QTL) in sheep. II. Meta-assembly and identification of novel QTL for milk production traits in sheep" docx
... related to total yield of lactation with k = ln (a) ; parameter b is related to the rate of increase prior to the lactation peak; and c is a parameter related to the rate of increase after the lactation ... LYCUM 10 5 DIK 51 4 7 82 10 5 1. 8 0. 51 25 FP 21 DIK24 51 6 31 2.0 -0. 51 25 UP 21 DIK24 51 7 35 2 .1 -0 .54 QTL detected for the milk tra...
Ngày tải lên: 14/08/2014, 13:21
Báo cáo sinh học: " Exploration of lagged relationships between mastitis and milk yield in dairy cows using a Bayesian structural equation Gaussian-threshold model" pdf
... residual covariance matrix R 0 is partitioned into a component per- taining to the bth binary trait (r b,b ), vectors containing the covariance components between the bth trait and all other traits ... matrix. When there are binary characters, because the variance of the liabilities of each binary character is fixed at 1, the residual covariance matrix R 0 is sampled f...
Ngày tải lên: 14/08/2014, 13:22