0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo sinh học: " Epistatic QTL pairs associated with meat quality and carcass composition traits in a porcine Duroc × Pietrain population" pptx

Báo cáo sinh học:

Báo cáo sinh học: " Epistatic QTL pairs associated with meat quality and carcass composition traits in a porcine Duroc × Pietrain population" pptx

... 2003,120:103-110.doi:10.1186/1297-9686-42-39Cite this article as: Große-Brinkhaus et al.: Epistatic QTL pairs associated with meat quality and carcass composition traits in a porcine Duroc × Pietrain population. Genetics Selection ... study, 56 epistatic QTL pairs involving 104interacting QTL positions were identified across all theautosomes for porcine carcass composition and meat quality traits. As shown in Tables 2 and Additional ... togenetic variat ion in carcass composition and meat qual-ity traits. Subdividing epistatic effects into the structuraltypes (a × a, a × d, d × a and d × d) allows a deeperinsight into the genetic...
  • 13
  • 419
  • 0
Báo cáo y học:

Báo cáo y học: " Self-esteem is associated with premorbid adjustment and positive psychotic symptoms in early psychosis" doc

... analysis and interpretation of data and drafting themanuscript. JIR has made substantial contribution to conception and design,analysis and interpretation, drafting of the manuscript and have beenrevising ... regard to the TOPresearch study. For DSM-IV diagnostics mean o verallkappa with training videos was 0.77, and mean overallkappa for a randomly drawn subset of actual studypatients was also ... were interviewed by trained psychologists and psychiatrists at the same time as the SCID-I wasadministered. The investigators had all completed generaltraining and a reliability program with...
  • 8
  • 371
  • 0
báo cáo khoa học:

báo cáo khoa học: " Identification of genes associated with growth cessation and bud dormancy entrance using a dormancy-incapable tree mutant" doc

... 5’-CAGAGGGCAAGCAACTACCAC-3’R5’-CCAGAGAAATTATGGAAGCCCCA-3’Dormancy associated MADS-box gene 6 (PpDAM6) GE653238 F 5’-CCAACAACCAGTTAAGGCAGAAGA-3’R5’-GGAAGCCCCAGTTTGAGAGA-3’Epicotyl-specific tissue protein GE653203 F 5’-CACCAAAAGAGAAAGCCGACTGC-3’R5’-TCAACCTCAACGTCAACCTCAAC-3’RD22 ... 5’-ATGGCAAACCACCAAGCACTCA-3’R5’-GTAGAGGAGCCTTGATTGGAGGAG-3’Unknown3 GE653309 F 5’-AAGTTGTCCATCCCAACACATTCG-3’R5’-GCGAGGACATCTCTGGCAATAAGA-3’Unknown4 GE653307 F 5’-TCCTCAACGAACAGACGGAACTC-3’R5’-TGGTGGTCTTGGAAATGCTGGT-3’Jiménez ... (DEAD-box helicase) GE653257 F 5’-TGTAGCCAGCAGCCTTAGCAAG-3’R5’-GCCAGTTGATGTTGCCAAAGCAG-3’Zinc ion binding/LIM GE653319 F 5’-AGAAGAGGATGAGGAGGAAGACG-3’R5’-GTTGTTGACAGGGTCGATTCTGG-3’ATP-binding...
  • 11
  • 317
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Large-scale association study for structural soundness and leg locomotion traits in the pig" pptx

... [13].bDanish Landrace and Danish Yorkshire [10].cFinish Landrace and Finish Large White [11].dCommercial Landrace × Large White [12].eAdjusted data by subtracting 5 from the original score and ... analyses of CALCR and COL 1A2 All four SNPs within CALCR and the two SNPs withinCOL 1A2 displayed a strong association with the analyzed traits, and these two genes are located adjacent to eachother ... and data analysis and manuscript preparation. BEM, TS and KJS carried out the traits scoring on field and data collection. MFR conceivedthe study, and participated in its design and coordinationand...
  • 9
  • 423
  • 0
Báo cáo y học:

Báo cáo y học: " Nocardia cyriacigeorgica bacteraemia presenting with cytomegalovirus disease and rapidly fatal pneumonia in a renal transplant patient: a case report" ppsx

... using partial sequencing of the 16S rDNA and cluster analysis of thegyraseB gene, and helped to draft the manuscript and perform the literaturereview. All authors read and approved the final ... potassium 5.8 mmol/L, urea49.7 mmol/L, creatinine 447 μmol/L, bilirubin 18 μmol/L, alanine aminotransfer ase 60i u/L, alkaline phospha-tase 92i u/L, total protein 60 g/L, albumin 25 g/L, and C-reactive ... disease and rapidly fatal pneumonia in a renal transplant patient: a case report. Journal of Medical CaseReports 2011 5:228.Submit your next manuscript to BioMed Central and take full advantage of:...
  • 4
  • 324
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program" doc

... nature of the relationshipbetween inflammation and cancer: inflammation cancause cancer; inflammation can cause mutation; muta-tion can cause inflammation; mutation can cause cancer; and cancer ... STAT1, STAT3, and STAT5 pathways. In clinical trials, IL-21 has shown promising clinicalbenefits among patients with melanoma and renal can-cer. IL-21 may find additional clinical applications ... educational offerings associated with the society’s 25th anniversary. The target audience was basic and clinical investigators from academia, industry and regulatory agencies, and included clinicians,...
  • 15
  • 602
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Multivariate restricted maximum likelihood estimation of genetic parameters for production traits in three selected turkey strains" pps

... sex-limited trait.It is assumed that yj , ai , and ei are normally distributed with: and After reordering the data by trait within animal, let a and e be the vectors ofadditive ... study was based on data from three selected strains of turkeys, referred toas strains A, B and C. Strains A and B are female lines. Strain C is a maleline, which ... that ignoringsome random effects in genetic evaluation may still result in unbiased estimates and predictions, but with increases in the sampling variances compared with...
  • 19
  • 255
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Multivariate restricted maximum likelihood estimation of genetic parameters for production traits in three " ppt

... correlation between EN1* and EN2* was high in strain A as well as in strain B. EN1* was negatively genetically correlated with body weight in strain A and especially with ... univariate analyses. Unfortunately, the computationalburden involved by a multivariate analysis for t traits is far greater than for t uni-variate analyses. As detailed in ... compared with those obtained in an analysis including all selected traits. For both analyses, thegenetic parameters were nearly identical.candidates, but one must be aware...
  • 19
  • 325
  • 0
Báo cáo y học:

Báo cáo y học: "Henoch-Schönlein nephritis associated with streptococcal infection and persistent hypocomplementemia: a case report" pot

... Rivera, S Anaya, MD Sánchez de la Nieta and MC Vozmediano analyzed and interpreted our patient data regarding the renal disease.J Pérez-Alvárez and J Blanco performed the histological examination ... (normal under240), serum total proteins 6 g/dL and albumin 3.7 g/dL.Coagulation study was not altered. ANA, anti-DNA,ANCAS, antibodies anti-MBG, crioglobulins, lupusanticogalulant and anticardi ... weeks la ter, she developed arthralgias and astheniafollowed by purpura on legs, arms and abdomen. Therewas no abdominal pain or oedema. During physicalexamin ation, blood pressure was 100/45...
  • 5
  • 406
  • 0
Báo cáo y học:

Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

... CAAACTCTTTTGCTTGGGCTR CACTGGACAACTCGCAGATGAF125041Biglycan 65 204 F CCATGCTGAACGATGAGGAAR CATTATTCTGCAGGTCCAGCAF034842Fibromodulin 65 442 F CTGGACCACAACAACCTGACR GGATCTTCTGCAGCTGGTTGAF020291Lumican 65 ... CCTCCAGGTCAGCTTCGCAANM174030Collagen I 65 460 F CCACCAGTCACCTGCGTACAR GGAGACCACGAGGACCAGAAAF129287Collagen III 55 243 F GCTGGCTAGTTGTCGCTCTGR GTGGGGAAACTGCACAACATL47641GAPDH 55 320 F TCACCATCTTCCAGGAGCGAR GGCGTGGACAGTGGTCATAAAF035421Shown ... animalsmay permit analysis of affected and unaffected cartilage withinone joint area.Although morphological and histological changes in cartilagewere most notable in the lateral compartment, changes...
  • 10
  • 416
  • 0

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ