Báo cáo sinh học: "Estimation in a multiplicative mixed model involving a genetic relationship matrix" pps

báo cáo sinh học:" Scaling up proven public health interventions through a locally owned and sustained leadership development programme in rural Upper Egypt" ppt

báo cáo sinh học:" Scaling up proven public health interventions through a locally owned and sustained leadership development programme in rural Upper Egypt" ppt

... article as: Mansour et al.: Scaling up proven public health interventions through a locally owned and sustained leadership development programme in rural Upper Egypt. Human Resources for Health 2010 ... of health around the globe, well led and managed health programmes are crucial f or producing health improvements that can be maintained. In Asw...

Ngày tải lên: 18/06/2014, 17:20

6 368 0
báo cáo sinh học:" Increasing health worker capacity through distance learning: a comprehensive review of programmes in Tanzania" ppt

báo cáo sinh học:" Increasing health worker capacity through distance learning: a comprehensive review of programmes in Tanzania" ppt

... mobile phones. Challenges and constraints of distance learning programmes for health care workers Distance learning in Tanzania faces many challenges and constraints. Resources are inadequate, including funding, ... se of health care worker in- service training, qualifications upgrading, and post gradu- ate training as a way to motivate and retain health care workers....

Ngày tải lên: 18/06/2014, 17:20

10 438 0
Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

Báo cáo sinh học: " Vaccinia virus A12L protein and its AG/A proteolysis play an important role in viral morphogenic transition potx

... the A12L protein during VV mor- phogenic transitions and regulation of A12L proteolysis. Conclusion By demonstrating that A12L protein and its cleavage at an N-terminal AG/A play an important role ... [7,8]. L4R, a DNA binding protein, plays an essential role in virus replication, being involved in an early stage of infection such as early tran- scri...

Ngày tải lên: 18/06/2014, 18:20

6 397 0
Báo cáo sinh học: "Time-course of sFlt-1 and VEGF-A release in neutropenic patients with sepsis and septic shock: a prospective study" pptx

Báo cáo sinh học: "Time-course of sFlt-1 and VEGF-A release in neutropenic patients with sepsis and septic shock: a prospective study" pptx

... observation of higher sFlt-1 and VEGF -A levels in non -neutropenic patients with sepsis at “early” time points. Again, we believe that rather than a difference in the kinetics of sFlt-1 and VEGF -A release ... the time of fever onset was not assessed. Figure 3 sFlt-1 and VEGF -A levels in patients with FN . Combined analysis sFlt-1 and VEG...

Ngày tải lên: 18/06/2014, 19:20

8 491 0
Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot

Báo cáo sinh học: "Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma" pot

... this article as: Takikita et al.: Membranous expression of Her3 is associated with a decreased survival in head and neck squamous cell carcinoma. Journal of Translational Medicine 2011 9:126. Submit ... immunohistochemistry for Her2 (a, membranous staining and Her3 (b, membranous and cytoplasmic staining, and c, predominant cytoplasmic staining) 400 ì m...

Ngày tải lên: 18/06/2014, 22:20

10 491 0
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc

Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc

... Access Review Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases Hervé Le Calvez* 1 , Mang Yu 2 and Fang Fang 2 Address: 1 Abgent, Inc. 6310 Nancy Ridge Drive, ... antibody indicated for prevention and treatment of respiratory syncytial virus (RSV) has heralded a new era for viral...

Ngày tải lên: 18/06/2014, 22:20

6 568 0
Báo cáo hóa học: " Research Article Static Object Detection Based on a Dual Background Model and a Finite-State Machine Rub´ n Heras Evangelio and Thomas Sikora e" doc

Báo cáo hóa học: " Research Article Static Object Detection Based on a Dual Background Model and a Finite-State Machine Rub´ n Heras Evangelio and Thomas Sikora e" doc

... 2007. [4 ]A. Singh,S.Sawan,M.Hanmandlu,V.K.Madasu,andB. C. Lovell, “An abandoned object detection system based on dual background segmentation,” in Pr oceedings of the 6th IEEE International Conference on Advanced Video and ... detections indicate that an abandoned object was detected where, in fact, there was not an abandoned object (but, for example, a person). Missed...

Ngày tải lên: 21/06/2014, 07:20

11 377 0
Báo cáo sinh học: "Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression" ppt

Báo cáo sinh học: "Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression" ppt

... Research article Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell- cycle progression Ian Conlon and Martin Raff Address: MRC Laboratory for Molecular Cell ... checkpoint, because the larger cells do not double their cell mass each cycle, and the smaller cells more than double their cell mass each cycle [10]....

Ngày tải lên: 06/08/2014, 18:20

10 424 0
Báo cáo sinh học: "Madm (Mlf1 adapter molecule) cooperates with Bunched A to promote growth in Drosophila" pot

Báo cáo sinh học: "Madm (Mlf1 adapter molecule) cooperates with Bunched A to promote growth in Drosophila" pot

... that a kinase binding to Madm phosphorylates BunA. An analogous model was proposed for murine Mlf1 as Madm binds to an unknown kinase that phosphorylates Madm itself and a 14-3-3zeta-binding ... Heisterkamp N: Interaction of the small GTPase Rac3 with NRBP, a protein with a kinase-homology domain. Int J Mol Med 2002, 9:451-459. 48. Bard F, Casano L, Mallabiabarrena A, W...

Ngày tải lên: 06/08/2014, 19:21

15 286 0
Báo cáo sinh học: "Decrease in Shiga toxin expression using a minimal inhibitory concentration of rifampicin followed by bactericidal gentamicin treatment enhances survival of Escherichia coli O157: H7-infected BALB/c mice" pdf

Báo cáo sinh học: "Decrease in Shiga toxin expression using a minimal inhibitory concentration of rifampicin followed by bactericidal gentamicin treatment enhances survival of Escherichia coli O157: H7-infected BALB/c mice" pdf

... Access Decrease in Shiga toxin expression using a minimal inhibitory concentration of rifampicin followed by bactericidal gentamicin treatment enhances survival of Escherichia coli O157: H7-infected ... et al.: Decrease in Shiga toxin expression using a minimal inhibitory concentration of rifampicin followed by bacterici...

Ngày tải lên: 12/08/2014, 17:20

7 279 0
Báo cáo sinh học: "Estimation in a multiplicative mixed model involving a genetic relationship matrix" pps

Báo cáo sinh học: "Estimation in a multiplicative mixed model involving a genetic relationship matrix" pps

... the algebra to form mixed model estimates and validate software, and carried out the data analysis. RT and BC conceived the study, and BC and JE partici- pated in its design and coordination. AG ... account for model parsimony, an Akaike Information criteria (AIC) is calculated for each model, and models are compared by forming the difference in AIC between each model and the bes...

Ngày tải lên: 14/08/2014, 13:21

9 271 0
Báo cáo sinh học: "Estimation of genetic variability and selection response for clutch length in dwarf brown-egg layers carrying or not the naked neck gene" pdf

Báo cáo sinh học: "Estimation of genetic variability and selection response for clutch length in dwarf brown-egg layers carrying or not the naked neck gene" pdf

... affecting clutch length. Selection on clutch length in layers 233 4.2. Phenotypic trends, selection response, and the effect of the NA gene Selection for average clutch length in the dwarf laying ... 2003 DOI: 10.1051/gse:2003005 Original article Estimation of genetic variability and selection response for clutch length in dwarf b...

Ngày tải lên: 14/08/2014, 13:22

20 260 0
Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot

Báo cáo sinh học: " Substitution of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene" pot

... of the α-lactalbumin transcription unit by a CAT cDNA within a BAC clone silenced the locus in transgenic mice without affecting the physically linked Cyclin T1 gene Solange S OULIER a , Marthe ... using the BAC DNA as the template and oligos 5  GGTCGACTTATATATTTATGAACACATTTA 3  and 5  CCCGGGATAACTTCGTATAATGTATGCTATACGAACGGTATCCT-...

Ngày tải lên: 14/08/2014, 13:22

9 359 0
Báo cáo sinh học: " Factors influencing the efficiency of a marker-assisted introgression programme in Merino sheep" ppt

Báo cáo sinh học: " Factors influencing the efficiency of a marker-assisted introgression programme in Merino sheep" ppt

... pro- grammes in the case of a situation concerning sheep breeding. This study in- vestigated two factors and their interactions that in uence the backcross gen- eration of an MAI breeding programme and therefore ... measure. The factor causing the most in uence on the different backcrossing strate- gies in the MAI breeding programme was the availability of g...

Ngày tải lên: 14/08/2014, 13:22

17 199 0
Báo cáo sinh học: " Genes influencing milk production traits predominantly affect one of four biological pathways" pps

Báo cáo sinh học: " Genes influencing milk production traits predominantly affect one of four biological pathways" pps

... www.gse-journal.org DOI: 10.1051/gse:2007038 Original article Genes influencing milk production traits predominantly affect one of four biological pathways Amanda Jane Chamberlain ∗ , Helen Clare ... few genes affect both traits, or that many genes affect both traits, but sometimes in the same direction and other times in the opposite direction. In the case of ma...

Ngày tải lên: 14/08/2014, 13:22

11 115 0
Từ khóa:
w