Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx

... matrices of genetic distances based on genotypes at supposedly neutral markers on the one hand, and at markers in QTL regions, on the other hand, showed that none of the markers in the QTL regions ... that helps to distinguish the in uence of selection from the in uence of drift. Here, we investigate the joint evolution ofneutral and selecte...

Ngày tải lên: 14/08/2014, 13:21

... all related to infection including the Toll-like receptor signalling pathway genes (CD14, NFKBIA and TIRAP) which are essential in the innate immunity response to gram-negative infection. The results ... Genes) that participate in a given function or pathway, relative to the total number of occurrences of these genes in all functional/pathway annotations stored in the...

Ngày tải lên: 14/08/2014, 13:22

... shorter in high-line pigs than in low-line pigs, a distance that coincides with the combined length differences of the metacarpal bones and ulna in these same lines of pigs. For ... three lines of pigs at the beginning of the selection experiment. These structural differences created biomechanical imbalance in the musculoskeletal...

Ngày tải lên: 14/08/2014, 20:20

... var- iation of HCV revealed a diversification of type 1 HCV strains circulating in that region [8-12]. There is no knowl- edge about the degree of genetic variability of HCV strains circulating in ... for epidemiological linkage, to corroborate transmission link hypothesis or sequence relatedness studies [18-21]. The identification of a sequence signature in the 5'N...

Ngày tải lên: 18/06/2014, 18:20

... proteins are inhibitory to the genome of the cell that created them, but they aid the host population by either inhibiting the growth of the resident pathogen or by killing their host to favor the ... viruses of the same kind (or incompatibility group) from invading and replacing it. The latter proteins prevent the concomitant growth of a variety of non-related p...

Ngày tải lên: 18/06/2014, 18:20

... related to the N-terminus of ATP-citrate lyases [113]. Succinate dehydrogenase (SDH) Succinate  FAD ! fumarate  FADH 2 SDH (EC 1.3.5.1) is located in m itochondria and is attached to the inner ... 4.1.3.1) catalyzes the cleavage of isocitrate into succinate and glyoxylate. The reactions catalyzed by ICL and malate synthase (MS) do not occur in the tricarboxylic acid...

Ngày tải lên: 22/02/2014, 04:20

... expressed in the liver. Our results support the hypothesis that fish ZP proteins were originally synthesized in the ovary, and then the site of synthesis was switched to the liver during the evolutionary ... synthesized in the oocyte, except for chicken ZP1 and ZP3, which are synthesized in the liver and in the granulosa cells of the ovary, respectivel...

Ngày tải lên: 15/03/2014, 23:20

... quality of teaching and might, indirectly overcome the problem of increased numbers of students. The problems of insufficient students' clinical training and lack of practical training on ... education institutions; e) developing Management Information Systems (MIS); and f) increasing the sources of information, preparing laboratories, and organizing their usage...

Ngày tải lên: 18/06/2014, 17:20

... NL-TM-F, CATGGAGATGCAACCTATAATAGTAGCAATAGTAG- CATT AGTAGTAGCAATAATAATAGCAATAGCTGTGT- GGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTAC- TATTATAGGTTGCATCTC; ... NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTAC- TATTATAGGTTGCATCTC; for the R5 vpu TM region, R5- TM-F, CATGGAGATGTTAAATTTA...

Ngày tải lên: 18/06/2014, 18:20

... (Methodenhandbuch), which is intended for the use in the material flow-orientated assessment of research within the scope of the funding programme and the entire bioenergy sector. In the past, ... technical and economic aspects. Work tasks are, among others, the determination of the potential by means of humus balancing, the analysis of climate impacts...

Ngày tải lên: 18/06/2014, 18:20