Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx
Báo cáo sinh học: " Evolution of the polymorphism at molecular markers in QTL and non-QTL regions in selected chicken lines (Open Access publication)" ppsx
... matrices of genetic distances based on genotypes at supposedly neutral markers on the one hand, and at markers in QTL regions, on the other hand, showed thatnone of the markers in the QTL regions ... that helps to distinguish the in uence of selection from the in uence of drift.Here, we investigate the joint evolution ofneutral and selected genomic regions, using observations on microsatellite ... genotypes at all markers in QTL regions, on the other hand.2.4. Evolution of marker polymorphism within lines 2.4.1. Temporal changes in allele frequencies In order to d etect markers for which the evolution...
- 23
- 319
- 0
Báo cáo sinh học: " Analysis of the real EADGENE data set: Multivariate approaches and post analysis (Open Access publication)" doc
... all related to infection including the Toll-like receptorsignalling pathway genes (CD14, NFKBIA and TIRAP) which are essential in the innate immunity response to gram-negative infection. The results ... Genes) that participate in a given function or pathway, relative to the total number of occurrences of these genes in all functional/pathway annotationsstored in the Ingenuity Pathways Knowledge Base.different ... correlated more than expected by chance when the infective pathogen was S. aureus (Fig. 4).3.3. Annotation of bovine genes In total, 2254 out of 8126 Unigene ID in the original bovine annotationfile...
- 18
- 291
- 0
Báo cáo sinh học: "Effects of divergent selection for leg weakness on muscle and bone characteristics in Duroc swine* ppt
... shorter in high-line pigs than in low-line pigs, a distance that coincideswith the combined length differences of the metacarpal bones and ulna in thesesame lines of pigs.For ... three lines of pigs at the beginning of the selectionexperiment. These structural differences created biomechanical imbalance in the musculoskeletal structure resulting in leg ... weakness. Lines were low, control, and high, with the low line having the greatest leg weakness and the high-line having the least leg weakness. At a slaughter weight of approximately...
- 12
- 238
- 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc
... var-iation of HCV revealed a diversification of type 1 HCVstrains circulating in that region [8-12]. There is no knowl-edge about the degree of genetic variability of HCV strainscirculating in ... forepidemiological linkage, to corroborate transmission linkhypothesis or sequence relatedness studies [18-21]. The identification of a sequence signature in the 5'NCR of type1 HCV strains isolated in ... comparable sequences of HCV strainsisolated in other regions of South America. In order tocompare the results found for the South American regionwith other regions of the world, the same approach...
- 12
- 354
- 0
Báo cáo sinh học: " Evolution of temperate pathogens: the bacteriophage/bacteria paradigm" potx
... proteins areinhibitory to the genome of the cell that created them, butthey aid the host population by either inhibiting the growth of the resident pathogen or by killing their host tofavor the ... viruses of the same kind (orincompatibility group) from invading and replacing it. The latter proteins prevent the concomitant growth of avariety of non-related pathogens. Possibly, the otherknown ... purpose of the mecha-nism from the point of view of the pathogen is to elimi-nate pathogen-free cells. This allows the population of pathogen-containing cells to survive a competition of pathogen-free...
- 9
- 490
- 0
Tài liệu Báo cáo Y học: Evolution of the enzymes of the citric acid cycle and the glyoxylate cycle of higher plants pdf
... related to the N-terminus of ATP-citrate lyases [113].Succinate dehydrogenase (SDH)Succinate FAD ! fumarate FADH2SDH (EC 1.3.5.1) is located in m itochondria and is attachedto the inner ... 4.1.3.1) catalyzes the cleavage of isocitrate intosuccinate and glyoxylate. The reactions catalyzed by ICL and malate synthase (MS) do not occur in the tricarboxylicacid cycle. They are usually catalyzed ... obtain an o verview of the patterns of similarity for t he enzymes o f these pathways in plants and the relationships of their differentially compartmentalizedisoenzymes. Condensing the information...
- 16
- 474
- 0
Báo cáo khoa học: Evolution of the teleostean zona pellucida gene inferred from the egg envelope protein genes of the Japanese eel, Anguilla japonica potx
... expressed in the liver. Our results support the hypothesisthat fish ZP proteins were originally synthesized in the ovary, and then the site of synthesis was switched to the liver during the evolutionary ... synthesized in the oocyte, except for chicken ZP1 and ZP3, which aresynthesized in the liver and in the granulosa cells of the ovary, respectively [9]. The C-terminal regions of the ZP proteins ... lane. The numberson the left indicate the sizes of the RNA size markers. (B) Semi-quantitative analysis of expression of ezp genes by RT-PCR. The numbers of the PCR cycle are indicated at the...
- 11
- 436
- 0
báo cáo sinh học:" Review of the utilization of HEEPF – competitive projects for educational enhancement in the Egyptian medical sector" potx
... quality of teaching and might,indirectly overcome the problem of increased numbers of students. The problems of insufficient students' clinicaltraining and lack of practical training on ... education institutions; e) developing ManagementInformation Systems (MIS); and f) increasing the sources of information, preparing laboratories, and organizingtheir usage [15].HEEPF financed ... challenged the system of highereducation in the past decades, mainly an increasing student enrollment, limited resources, and oldgovernance and bylaws. These constraints and the escalating paucity of...
- 8
- 697
- 0
Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt
... NL-TM-F,CATGGAGATGCAACCTATAATAGTAGCAATAGTAG-CATT AGTAGTAGCAATAATAATAGCAATAGCTGTGT-GGTCCATAGTAATCATAGAATAGG and NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; ... NL-TM-R,AATTCCTATTCTATGATTACTATGGACCACACAGCTATTGCTATTATTATTGCTACTACTAATGCTACTATTGCTAC-TATTATAGGTTGCATCTC; for the R5 vpu TM region, R5-TM-F,CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGGAGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGT-GGACCATAGTATATATAGAATAGG and R5-TM-R, AATTCCTATTCTATATATACTATGGTCCACACGACTATT-GCTATGATTAGTGCTA ... NL-X-F, GAATTCAT-GCAACCTATAATAGTAGCAATA and NL-R-GFP, GGATC-CGCG CAGATCATCAATATCC; for R5 vpu, R5-X-F,GAATTCATGTTAAATTTAG ATTATAAATTAGGAGTAGG and R5-R-GFP, GGATCCTGCCAAATCATT AACATC-CAAAA....
- 11
- 436
- 0
Báo cáo sinh học: " Optimisation of the use of biomass for energy production (Optimierung der energetischen Biomassenutzung) - a funding programme introduces itself" ppt
... (Methodenhandbuch), which is intended for the use in the material flow-orientated assessment of research within the scope of the funding programme and the entire bioenergy sector. In the past, ... technical and economic aspects. Work tasks are, among others, the determination of the potential by means of humus balancing, the analysis of climate impacts and the techno-economic analysis of the ... to heat and regenerate the bed material (releasing CO2) at temperatures higher than 800°C. Due to the high H2 content and the adjusted composition of the product gas, the generation of SNG...
- 19
- 559
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ