Báo cáo y học: "Natural selection of protein structural and functional properties: a single nucleotide polymorphism perspect" potx
... activity Oxidoreductase activity Transferase activity Hydrolase activity Lyase activity Isomerase activity Ligase activity Enzyme regulator activity Transcription regulator activity Translation regulator activity SNP ... manuscript. All authors read and approved the final manuscript. Additional data files The following additional data are available. Additional data file 1 includes Table S1...
Ngày tải lên: 14/08/2014, 08:21
... 12:656-664. 62. Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tom- ida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T: A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung ... nonhuman species that are aligned to human regulatory bases are also called regulatory. We under- stand that this definition is only made for the purposes of this analysis an...
Ngày tải lên: 14/08/2014, 07:21
... of protein modularity and tables with the data sets used for the analyses. Additional data file 1Additional examples of protein modularity and the datasets used for the analysesAdditional examples ... blocks of domains. The analysis of 13 allosteric proteins revealed that modules characterize experimentally identified functional regions. Based on the study of an additional...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: " Coordinate enhancement of transgene transcription and translation in a lentiviral vector" pps
... duplicate and the mean and standard deviation are presented. Western blotting Bradford assay was used to measure 50 µg of protein from nuclear and cytoplasmic fractions. Proteins were sepa- rated ... primers (5'TTTTTATCGATAAGCTCAATATTGGCCATATTATTCAT TGG3' and 5'TTTTCATATGCAGTTGTTACGACATTTTGGAAAG3') and ligated with NdeI-ClaI-digested PCE-Luc and U3-Luc in o...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: "Psychosocial predictors of sexual initiation and high-risk sexual behaviors in early adolescence" potx
... system, namely psychological and behavioral fac- tors. To study the psychological and behavioral correlates of risky adolescent sexual activity, we have used an addi- tional conceptual framework adopted ... debut among inner-city youth is thirteen years of age, three years earlier than the national average [4]. Addition- ally, African-American teens tend to initiate sex earlier than C...
Ngày tải lên: 13/08/2014, 18:21
Báo cáo Y học: Coordinated action of protein tyrosine phosphatases in insulin signal transduction potx
... Diabetes Institute, World Health Organisation). Clinically, diabetes is primarily characterized by fasting hyperglycemia, is often associated with cardio- vascular risk factors, and may lead ... phosphory- lation and activation. The only major defect caused by inhibition of IR internalization was impaired Shc tyrosine phosphorylation and MAPK activation. In summary, most of the acut...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo y học: "Strong inhibition of TNF-α production and inhibition of IL-8 and COX-2 mRNA expression in monocyte-derived macrophages by RWJ 67657, a p38 mitogen-activated protein kinase (MAPK) inhibitor" ppt
... LPS-induced TNF-alpha biosynthesis. Nat Cell Biol 1999, 1:94-97. 21. Bhattacharyya A, Pathak S, Datta S, Chattopadhyay S, Basu J, Kundu M: Mitogen-activated protein kinases and nuclear fac- tor-kappaB regulate ... phosphorylation of p38 MAPK and MAPKAPK-2Effect of RWJ 67657 on phosphorylation of p38 MAPK and MAP- KAPK-2. (a) Representative presentation of phosphorylation of...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Natural evolution of desmoplastic fibroblastoma on magnetic resonance imaging: a case report" ppt
... histopathological analysis and helped draft the manuscript. HM, TM, KM, HY and TY helped draft the manuscript. All authors have read and approved the final manuscript. Competing interests The authors ... 160-8582, Japan. 2 Department of Orthopaedic Surgery, Kyorin University, 6-20-2 Shinkawa, Mitaka, Tokyo 181-8611, Japan. 3 Department of Diagnostic Pathology, Keio University Hospit...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: " Elevated expression of both mRNA and protein levels of IL-17A in sputum of stable Cystic Fibrosis patients" potx
... intravenous (IV) antibiotic therapy). The aims of this study were to quantify both protein and mRNA levels of IL-1 7A and mRNA levels of IL-22 and IL-23 in sputum of stable CF patients and to relate expression ... the airway inflammation caused by P. aeruginosa was significantly reduced [21]. These data suggest that the continuous presence of Pseudomonal ant igens in the...
Ngày tải lên: 12/08/2014, 13:22
Báo cáo y học: "Natural variation of HIV-1 group M integrase: Implications for a new class of antiretroviral inhibitors" pdf
... [abstract 1]. Antivir Ther 2007, 12:S3. 54. Kodama E, Shimura K, Sakagami Y, Matsuzaki Y, Watanabe W, Yama- taka K, Sato M, Kano M, Ikeda S, Matsuoka M: In vitro antiviral activity and resistance ... NN, Young SD: A potent and orally active HIV-1 inte- grase inhibitor. Bioorg Med Chem Lett 2007, 17:1392-1398. 33. Shimura K, Kodama E, Sakagami Y, Matsuzaki Y, Watanabe W, Yama- taka K...
Ngày tải lên: 13/08/2014, 05:21