Báo cáo y học: "Natural selection of protein structural and functional properties: a single nucleotide polymorphism perspect" potx
Báo cáo y học: "Natural selection of protein structural and functional properties: a single nucleotide polymorphism perspect" potx
... activity
Oxidoreductase activity
Transferase activity
Hydrolase activity
Lyase activity
Isomerase activity
Ligase activity
Enzyme regulator activity
Transcription regulator activity
Translation regulator activity
SNP ... manuscript. All authors
read and approved the final manuscript.
Additional data files
The following additional data are available. Additional data
file 1 includes Table S1...
Báo cáo y học: "Regulatory conservation of protein coding and microRNA genes in vertebrates: lessons from the opossum genome" pptx
... 12:656-664.
62. Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tom-
ida S, Yatabe Y, Kawahara K, Sekido Y, Takahashi T: A polycistronic
microRNA cluster, miR-17-92, is overexpressed in human
lung ... nonhuman species that are aligned to
human regulatory bases are also called regulatory. We under-
stand that this definition is only made for the purposes of this
analysis an...
Báo cáo y học: "Modular architecture of protein structures and allosteric communications: potential implications for signaling proteins and regulatory linkages" pot
... of protein modularity and tables
with the data sets used for the analyses.
Additional data file 1Additional examples of protein modularity and the datasets used for the analysesAdditional examples ... blocks of domains. The analysis of 13 allosteric proteins revealed that modules characterize
experimentally identified functional regions. Based on the study of an additional...
Báo cáo y học: " Coordinate enhancement of transgene transcription and translation in a lentiviral vector" pps
... duplicate and the mean and
standard deviation are presented.
Western blotting
Bradford assay was used to measure 50 µg of protein from
nuclear and cytoplasmic fractions. Proteins were sepa-
rated ... primers
(5'TTTTTATCGATAAGCTCAATATTGGCCATATTATTCAT
TGG3' and
5'TTTTCATATGCAGTTGTTACGACATTTTGGAAAG3')
and ligated with NdeI-ClaI-digested PCE-Luc and U3-Luc
in o...
Báo cáo y học: "Psychosocial predictors of sexual initiation and high-risk sexual behaviors in early adolescence" potx
... system, namely psychological and behavioral fac-
tors. To study the psychological and behavioral correlates
of risky adolescent sexual activity, we have used an addi-
tional conceptual framework adopted ... debut among inner-city youth is thirteen years of age,
three years earlier than the national average [4]. Addition-
ally, African-American teens tend to initiate sex earlier
than C...
Báo cáo Y học: Coordinated action of protein tyrosine phosphatases in insulin signal transduction potx
... Diabetes Institute, World Health
Organisation). Clinically, diabetes is primarily characterized
by fasting hyperglycemia, is often associated with cardio-
vascular risk factors, and may lead ... phosphory-
lation and activation. The only major defect caused by
inhibition of IR internalization was impaired Shc tyrosine
phosphorylation and MAPK activation. In summary, most
of the acut...
Báo cáo y học: "Strong inhibition of TNF-α production and inhibition of IL-8 and COX-2 mRNA expression in monocyte-derived macrophages by RWJ 67657, a p38 mitogen-activated protein kinase (MAPK) inhibitor" ppt
... LPS-induced
TNF-alpha biosynthesis. Nat Cell Biol 1999, 1:94-97.
21. Bhattacharyya A, Pathak S, Datta S, Chattopadhyay S, Basu J,
Kundu M: Mitogen-activated protein kinases and nuclear fac-
tor-kappaB regulate ... phosphorylation of p38 MAPK and MAPKAPK-2Effect of RWJ 67657 on phosphorylation of p38 MAPK and MAP-
KAPK-2. (a) Representative presentation of phosphorylation of...
Báo cáo y học: "Natural evolution of desmoplastic fibroblastoma on magnetic resonance imaging: a case report" ppt
... histopathological analysis and helped draft
the manuscript. HM, TM, KM, HY and TY helped draft the manuscript. All
authors have read and approved the final manuscript.
Competing interests
The authors ... 160-8582, Japan.
2
Department of Orthopaedic Surgery,
Kyorin University, 6-20-2 Shinkawa, Mitaka, Tokyo 181-8611, Japan.
3
Department of Diagnostic Pathology, Keio University Hospit...
Báo cáo y học: " Elevated expression of both mRNA and protein levels of IL-17A in sputum of stable Cystic Fibrosis patients" potx
... intravenous
(IV) antibiotic therapy).
The aims of this study were to quantify both protein
and mRNA levels of IL-1 7A and mRNA levels of IL-22
and IL-23 in sputum of stable CF patients and to relate
expression ... the airway inflammation caused by
P. aeruginosa was significantly reduced [21]. These data
suggest that the continuous presence of Pseudomonal
ant igens in the...
Báo cáo y học: "Natural variation of HIV-1 group M integrase: Implications for a new class of antiretroviral inhibitors" pdf
... [abstract 1]. Antivir Ther 2007, 12:S3.
54. Kodama E, Shimura K, Sakagami Y, Matsuzaki Y, Watanabe W, Yama-
taka K, Sato M, Kano M, Ikeda S, Matsuoka M: In vitro antiviral
activity and resistance ... NN, Young SD: A potent and orally active HIV-1 inte-
grase inhibitor. Bioorg Med Chem Lett 2007, 17:1392-1398.
33. Shimura K, Kodama E, Sakagami Y, Matsuzaki Y, Watanabe W, Yama-
taka K...