Báo cáo y học: "Dietary weight loss and exercise interventions effects on quality of life in overweight/obese postmenopausal women: a randomized controlled trial" doc
... versions will be made available soon. Dietary weight loss and exercise interventions effects on quality of life in overweight/obese postmenopausal women: a randomized controlled trial International ... examine the individual and combined effects of dietary weight loss and/ or exercise interventions on HRQOL and psychosocial factors (depres...
Ngày tải lên: 14/08/2014, 08:21
... (bio-AAAAATGGGTCAACGTGGGCAA AGATGTCCTAGCAATGTAATCGTCTATGACGTT), 2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC ATGGAGCTGTCTAGAGGATCCGA). ... CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand 4 and a 37-bp duplex DNA by annealing oligonucleotides 5 (bio-...
Ngày tải lên: 17/03/2014, 17:20
... expression profile analysis. Clinical evaluation of arthritis As described by Nanakumar and coworkers [12], scoring of animals was done blindly using a scoring system based on the number of inflamed ... weeks after immunization and before clinical signs of arthritis manifested, animals were anaesthetized with ketamine (90 mg/kg body weight) and xylacin (6 mg/kg) and place...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: " Physiotherapy-supervised mobilization and exercise following cardiac surgery: a national questionnaire survey in Sweden" pot
... period in h ospital [4-7]. Physiotherapy management of patients undergoing cor- onary artery bypass graft (CABG) surgery [ 8] and thor- acic surgery [9] has been examined in Australia and New Zealand. ... a ph ysiotherapist on postoperative day 1, one to two treatment sessions on days 2 and 3, and typically one treatment on days 4 and 5. Physiotherapy treatment was nev...
Ngày tải lên: 10/08/2014, 09:22
Báo cáo y học: " Left atrial volume and exercise capacity in adult heart transplant recipient" ppsx
Ngày tải lên: 10/08/2014, 09:23
Báo cáo y học: " Sitagliptin is effective and safe as add-on to insulin in patients with absolute insulin deficiency: a case series" potx
... observed in the kid- ney (assessed on the basis of blood urea nitrogen and crea tinine levels) or liver (assessed by glutamate oxaloa- cetate transaminase, glutamate pyruvate transaminase, alkaline ... efficacy of sitagliptin in three Japanese patients (a 91-year-old Japanese woman with type 1 diabetes, a 54-year-old Japanese man with type 2 diabetes and a 30-year-old Japan...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: " Early Anti-inflammatory and anti-arthritic effects of yucca schidigera: A review" pdf
... protozoal theory of causation of arthritis has any merit, a role of yucca in arthritis treatment can be advanced on the basis of the anti-protozoal activity of yucca saponins. Representative blot of ... anti-arthritic and anti-inflammatory effects. The plant contains several physiologically active phytochemicals. It is a rich source of steroidal saponins, and is use...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " Previous hospital admissions and disease severity predict the use of antipsychotic combination treatment in patients with schizophrenia" pps
... 11:126 http://www.biomedcentral.com/1471-244X/11/126 Page 5 of 7 conception of the study, collecting data and revising the manuscript. LT: conception of the study, analysis, drafting and revising the manuscript. All authors have read and approved ... selection bias. Limitations Our data are based on a sample of cooperating patients who agreed to join the study, including all...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "Perforin, granzyme B, and FasL expression by peripheral blood T lymphocytes in emphysema" pptx
... fact that alveolar macrophages are markedly increased and highly activated in the paren- chyma of emphysematous lungs, and that they release much more proteases than in normal smokers and non- smokers ... T lymphocytes (CD16 - /CD8 + ), total RNA was extracted using RNeasy mini kit (Qiagen Inc.; Mississauga, ON, Canada) according to the manufacturer's instructions. To elim...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: " MicroRNA miR-146a and further oncogenesis-related cellular microRNAs are dysregulated in HTLV-1-transformed T lymphocytes" ppsx
... expression patterns of microRNAs and (b) available functional char- acterization, i.e., links to oncogenicity. While the patterns were based on data gathered in mice, comparability was maintained by ... Yamamoto M, Tsuji-Takayama K, Suzuki M, Harashima A, Sugimoto A, Motoda R, Yamasaki F, Nakamura S, Kibata M: Comprehensive analysis of FOXP3 mRNA expression in leukemia and tra...
Ngày tải lên: 13/08/2014, 05:21