Báo cáo y học: "Mediators of physical activity change in a behavioral modification program for type 2 diabetes patients" docx

Báo cáo y học: "Mediators of physical activity change in a behavioral modification program for type 2 diabetes patients" docx

Báo cáo y học: "Mediators of physical activity change in a behavioral modification program for type 2 diabetes patients" docx

... article as: Van Dyck et al.: Mediators of physical activity change in a behavioral modification program for type 2 diabetes patients. International Journal of Behavioral Nutrition and Physical ... finding also implies that interventions that can increase patients’ self-efficacy towards physical activity barriers seem to be particularly important for maint...

Ngày tải lên: 14/08/2014, 08:20

13 276 0
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

... utility in our medical–surgical ICU as part of a quality assurance survey. The goals of this study were to determine the percentage of routine and non-routine radio- graphs that change management in ... CXRs are beneficial to patient care. Brainsky et al observed that 20 % of routine CXRs performed in a medical ICU had ‘major important’ findings, and 8% prompted a chan...

Ngày tải lên: 25/10/2012, 10:45

5 507 0
 Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"

Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"

... Efficacy and toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas. Anticancer Res. 20 03; 23 : 3493-8. 15. Yamada H, Maki H, Takeda Y, et al. Evaluation of ... 2 , Tsutomu Nakamura 3 , Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2, 3  1. School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s University, Nishinomiya, Japan...

Ngày tải lên: 26/10/2012, 09:53

7 531 0
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc

Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc

... TCCTGAAACGCCTTCGGAAGAG E-selectin p10 CCATTGGGTTGAAGGCATTCG E-selectin p11 ACAAGGCCCCTGGCTGCT Exon 3 a1 ,3GalT-5¢ -A p 12 CCTGTCAAAAGAATAAACAGCGGTT Exon 3 a1 ,3GalT-5¢ -A p13 CACTGTTCCCTCAGCCGAGGAC ... 1 a1 ,3GalT-5¢-B and -E p14 CCAACTCCTGATCGGCAGAAGC Exon 1 a1 ,3GalT-5¢B and E p15 ACTTCTGAAGCCTAAAGGATGCGA Exon 2 a1 ,3GalT-5¢-C p16 AGGCAGGGCTGGGAGGAA Exon 3 a1 ,3GalT-5¢-C p17 TTGC...

Ngày tải lên: 08/03/2014, 16:20

10 444 0
Báo cáo y học: "Role of regulatory T cells in experimental arthritis and implications for clinical use" potx

Báo cáo y học: "Role of regulatory T cells in experimental arthritis and implications for clinical use" potx

... Epitope-specific immunotherapy induces immune deviation of proinflamma- tory T cells in rheumatoid arthritis. Proc Natl Acad Sci USA 20 04, 101: 422 8- 423 3. 118 RA = rheumatoid arthritis; T1D = type 1 diabetes; TNF ... polyendocrinopathy, enteropathy, X- linked syndrome) [4] or scurfy mice [5] or by means of depletion with anti-CD25 monoclonal antibodies in animal models, favour...

Ngày tải lên: 09/08/2014, 06:23

3 336 0
Báo cáo y học: "Manifestations of Ollier’s disease in a 21-year-old man: a case report" pdf

Báo cáo y học: "Manifestations of Ollier’s disease in a 21-year-old man: a case report" pdf

... examination [2, 5]. Scintigraphy has been recommended as useful in the monitoring of lesions and of the development of any malignant transformation [5]. Although the malignant transformation of ... considered as the cause of intensely increased uptake. Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images...

Ngày tải lên: 11/08/2014, 14:20

3 265 0
Báo cáo y học: " Effectiveness of an intercultural module added to the treatment guidelines for Moroccan and Turkish patients with depressive and anxiety disorders" ppt

Báo cáo y học: " Effectiveness of an intercultural module added to the treatment guidelines for Moroccan and Turkish patients with depressive and anxiety disorders" ppt

... actor in using an interpreter and in using the Cultural Formula- tion during treatment. The training takes two days. After the training the interven tion therapists join a monthly intercultur al ... been trained in cultural competence . The training program is based on existing modules that are widely used in the Netherlands and are based on international and national literature [...

Ngày tải lên: 11/08/2014, 16:23

7 350 0
Báo cáo y học: "Incidence of asthma and mortality in a cohort of young adults: a 7-year prospective study" ppt

Báo cáo y học: "Incidence of asthma and mortality in a cohort of young adults: a 7-year prospective study" ppt

... information about incidence of adult asthma and all causes mortality risk related to asthma in northern Italy, an area with a relatively low prevalence of asthma [14]. The main findings of our ... current asthma in the first study (having had an attack of asthma in the last 12 months or currently taking any medicine for asthma) as well as those who, in the second study, r...

Ngày tải lên: 12/08/2014, 18:22

10 377 0
Báo cáo y học: "Inclusion of the glucocorticoid receptor in a hypothalamic pituitary adrenal axis model reveals bistability" ppt

Báo cáo y học: "Inclusion of the glucocorticoid receptor in a hypothalamic pituitary adrenal axis model reveals bistability" ppt

... and fractals 20 05, 26 : 427 -436. 17. Lenbury Y, Pornsawad P: A delay-differential equation model of the feedback-controlled hypothalamus-pituitary-adrenal axis in humans. Math Med Biol 20 05, 22 :15-33. 18. ... the HPA axis. Background The hypothalamic pituitary adrenal (HPA) axis represents a self-regulated dynamic feedback neuroendocrine system that is essential for maintai...

Ngày tải lên: 13/08/2014, 16:21

12 284 0
Báo cáo y học: "Management of severe crush injury in a front-line tent ICU after 2008 Wenchuan earthquake in China: an experience with 32 cases" pot

Báo cáo y học: "Management of severe crush injury in a front-line tent ICU after 2008 Wenchuan earthquake in China: an experience with 32 cases" pot

... injury are in a state of hypo- tension and need intravenous administration of a large volume of fluids, including artificial plasma, 5% glucose, NaHCO3, aescigenin, and human serum albumin. Colloid ... Plast Surg 20 02, 25 :21 5 -21 8. 9. Michael JS, Michael EM: Reliability of vacuum phenomenon in the sacroiliac joint as a sign of traumatic injury. Emergency Radiology 2...

Ngày tải lên: 13/08/2014, 19:20

8 386 0
w