Báo cáo y học: "Mediators of physical activity change in a behavioral modification program for type 2 diabetes patients" docx
Báo cáo y học: "Mediators of physical activity change in a behavioral modification program for type 2 diabetes patients" docx
... article as: Van Dyck et al.: Mediators of physical activity change
in a behavioral modification program for type 2 diabetes patients.
International Journal of Behavioral Nutrition and Physical ... finding also implies that interventions that can
increase patients’ self-efficacy towards physical activity
barriers seem to be particularly important for maint...
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
... utility in our medical–surgical ICU as part of a
quality assurance survey. The goals of this study were to
determine the percentage of routine and non-routine radio-
graphs that change management in ... CXRs are beneficial to patient care. Brainsky et al
observed that 20 % of routine CXRs performed in a medical
ICU had ‘major important’ findings, and 8% prompted a
chan...
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... Efficacy and toxicity of
nedaplatin and 5-FU with radiation treatment for advanced
esophageal carcinomas. Anticancer Res. 20 03; 23 : 3493-8.
15. Yamada H, Maki H, Takeda Y, et al. Evaluation of ...
2
, Tsutomu Nakamura
3
, Kazusaburo Kataoka
1
and Toshiyuki Sakaeda
2, 3
1. School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s University, Nishinomiya, Japan...
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc
... TCCTGAAACGCCTTCGGAAGAG E-selectin
p10 CCATTGGGTTGAAGGCATTCG E-selectin
p11 ACAAGGCCCCTGGCTGCT Exon 3 a1 ,3GalT-5¢ -A
p 12 CCTGTCAAAAGAATAAACAGCGGTT Exon 3 a1 ,3GalT-5¢ -A
p13 CACTGTTCCCTCAGCCGAGGAC ... 1 a1 ,3GalT-5¢-B and -E
p14 CCAACTCCTGATCGGCAGAAGC Exon 1 a1 ,3GalT-5¢B and E
p15 ACTTCTGAAGCCTAAAGGATGCGA Exon 2 a1 ,3GalT-5¢-C
p16 AGGCAGGGCTGGGAGGAA Exon 3 a1 ,3GalT-5¢-C
p17 TTGC...
Báo cáo y học: "Role of regulatory T cells in experimental arthritis and implications for clinical use" potx
... Epitope-specific
immunotherapy induces immune deviation of proinflamma-
tory T cells in rheumatoid arthritis. Proc Natl Acad Sci USA
20 04, 101: 422 8- 423 3.
118
RA = rheumatoid arthritis; T1D = type 1 diabetes; TNF ... polyendocrinopathy, enteropathy, X-
linked syndrome) [4] or scurfy mice [5] or by means of
depletion with anti-CD25 monoclonal antibodies in animal
models, favour...
Báo cáo y học: "Manifestations of Ollier’s disease in a 21-year-old man: a case report" pdf
... examination [2, 5].
Scintigraphy has been recommended as useful in the
monitoring of lesions and of the development of any
malignant transformation [5]. Although the malignant
transformation of ... considered as the cause
of intensely increased uptake.
Consent
Written informed consent was obtained from the patient
for publication of this case report and any accompanying
images...
Báo cáo y học: " Effectiveness of an intercultural module added to the treatment guidelines for Moroccan and Turkish patients with depressive and anxiety disorders" ppt
... actor in
using an interpreter and in using the Cultural Formula-
tion during treatment.
The training takes two days. After the training the
interven tion therapists join a monthly intercultur al ... been
trained in cultural competence . The training program is
based on existing modules that are widely used in the
Netherlands and are based on international and national
literature [...
Báo cáo y học: "Incidence of asthma and mortality in a cohort of young adults: a 7-year prospective study" ppt
... information about incidence of adult
asthma and all causes mortality risk related to asthma in
northern Italy, an area with a relatively low prevalence of
asthma [14]. The main findings of our ... current
asthma in the first study (having had an attack of asthma
in the last 12 months or currently taking any medicine for
asthma) as well as those who, in the second study,
r...
Báo cáo y học: "Inclusion of the glucocorticoid receptor in a hypothalamic pituitary adrenal axis model reveals bistability" ppt
... and fractals 20 05, 26 : 427 -436.
17. Lenbury Y, Pornsawad P: A delay-differential equation model of
the feedback-controlled hypothalamus-pituitary-adrenal
axis in humans. Math Med Biol 20 05, 22 :15-33.
18. ... the HPA axis.
Background
The hypothalamic pituitary adrenal (HPA) axis represents
a self-regulated dynamic feedback neuroendocrine system
that is essential for maintai...
Báo cáo y học: "Management of severe crush injury in a front-line tent ICU after 2008 Wenchuan earthquake in China: an experience with 32 cases" pot
... injury are in a state of hypo-
tension and need intravenous administration of a large volume
of fluids, including artificial plasma, 5% glucose, NaHCO3,
aescigenin, and human serum albumin. Colloid ... Plast Surg
20 02, 25 :21 5 -21 8.
9. Michael JS, Michael EM: Reliability of vacuum phenomenon in
the sacroiliac joint as a sign of traumatic injury. Emergency
Radiology 2...