Báo cáo y học: "Qualitative and quantitative research into the development and feasibility of a video-tailored physical activity intervention" pptx

Báo cáo y học: "Qualitative and quantitative research into the development and feasibility of a video-tailored physical activity intervention" pptx

Báo cáo y học: "Qualitative and quantitative research into the development and feasibility of a video-tailored physical activity intervention" pptx

... development and feasibility of a video- tailored physical activity intervention. International Journal of Behavioral Nutrition and Physical Activity 2011 8:70. Vandelanotte and Mummery International Journal ... 11 6. Department of Health and Aged Care (DHAC): National Physical Activity Guidelines for Australians. Commonwealth Department of Health and Ageing...

Ngày tải lên: 14/08/2014, 08:20

11 427 0
Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot

Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot

... in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report James Lenton* and Tze Wah Address: Department of Radiology, St James University Hospital, ... abscess. Case presentation A 53-year-old British Caucasian woman presented to urol- ogists with increasing right flank pain and pyrexia. Urine analysis was negative, and initial...

Ngày tải lên: 11/08/2014, 21:22

3 306 0
Báo cáo y học: "An in vitro study investigating the survival and phenotype of mesenchymal stem cells following injection into nucleus pulposus tissue" pot

Báo cáo y học: "An in vitro study investigating the survival and phenotype of mesenchymal stem cells following injection into nucleus pulposus tissue" pot

... the type X collagen and Alizarin red staining, and participated in interpretation of the data. AJF participated in interpretation of the data and contributed to the preparation of the final manuscript. ... days and any nonadher- ent cells were removed. MSCs (characterised by their adher- ence to plastic and morphology) were then expanded in a monolayer and used a...

Ngày tải lên: 09/08/2014, 01:22

10 434 0
Báo cáo y học: "Decreased GABAB receptor function in the cerebellum and brain stem of hypoxic neonatal rats: Role of glucose, oxygen and epinephrine resuscitation" pot

Báo cáo y học: "Decreased GABAB receptor function in the cerebellum and brain stem of hypoxic neonatal rats: Role of glucose, oxygen and epinephrine resuscitation" pot

... hypoxic neonatal rats: Role of glucose, oxygen and epinephrine resuscitation Thoppil R Anju, Sadanandan Jayanarayanan and Cheramadatikudiyil S Paulose * Abstract Background-: Hypoxia during the first ... GAD, the rate limiting enzyme of GABA synthesis and a key protein in the GABA path- way, is used as a marker for GABAergic activity. Thus, understanding the diagnosis,...

Ngày tải lên: 10/08/2014, 05:21

11 467 0
Báo cáo y học: " Subcutaneous hydatid cysts occurring in the palm and the thigh: two case reports" ppt

Báo cáo y học: " Subcutaneous hydatid cysts occurring in the palm and the thigh: two case reports" ppt

... primary subcutaneous hydatid cysts are very rare [4-6], and we were unable to find a case of a palmar hydatid cyst in a literature review. In our cases, the hydatid cysts were located subcutaneously, ... Y ldırım S: Hydatid cyst in the soft tissue of the face without any primary. Ann Plast Surg 2001, 46:170-173. 6. Ambo M, Adachi K, Okhawara A: Postoperative alveolar hydat...

Ngày tải lên: 11/08/2014, 21:22

4 224 0
Báo cáo y học: " Glutathione S-transferase omega in the lung and sputum supernatants of COPD patients" potx

Báo cáo y học: " Glutathione S-transferase omega in the lung and sputum supernatants of COPD patients" potx

... of the airways, it can be hypothesized that GSTO may participate in the maintenance of GSH not only intracellularly, but also in the extracellular space and this may be modulated by oxidative ... immunohistochemical results and per- formed part of the statistical analysis. YS and KMS partic- ipated in selection of patient material and analyzing the immunohistochemica...

Ngày tải lên: 12/08/2014, 15:20

9 426 0
Báo cáo y học: "HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form" pdf

Báo cáo y học: "HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form" pdf

... CTGGAACKCTAGTTGGAGTAAT MO042 gag p24 OF- 1 890-909 TAGTATGGGCAAGCAGGGAG MO024 gag p24 OF- 2 508 - 527 AACCCACTGCTTAAGCCTCA MO044 gag p24 OR 2272-2252 TGCCAAAGAGTGATTTGAGGG MO043 gag p24 IF 1048-1067 TGYGTRCATCAAARGATAGA MO045 ... CAAGCATGKGTAGCCCAGAYATTATG MO188 p24 to env IF 2034 - 2060 ATGTGGGAARGARGGACACCAAATGAA MO189 p24 to env IR 6335 - 6360 TCCACACAGGTACCCCATAATAGACT MO191 5’ LTR to g...

Ngày tải lên: 13/08/2014, 01:20

14 334 0
Báo cáo y học: "Measuring cough severity: Perspectives from the literature and from patients with chronic cough" docx

Báo cáo y học: "Measuring cough severity: Perspectives from the literature and from patients with chronic cough" docx

... were remunerated $50 for their participation. Qualitative Analysis Approach A content analysis approach was used to analyze the data (transcripts, field notes and audio-recordings) from the focus ... ± 12.9 years, and 72.7% of the sample was female. Among study participants, all were Caucasian and more than half the sample reported a household income greater than $60,000 p...

Ngày tải lên: 13/08/2014, 08:20

8 274 0
Báo cáo y học: "Macrophage migration inhibitory factor, infection, the brain, and corticosteroids" ppsx

Báo cáo y học: "Macrophage migration inhibitory factor, infection, the brain, and corticosteroids" ppsx

... by the causative organism and, in part, by the host’s own inflammatory response. Macrophage migration inhibitory factor (MIF) is a pro-inflammatory cytokine and a neuro-endocrine mediator that ... [5]. As a pro-inflammatory cytokine, MIF is produced in response to endotoxin, exotoxins, Gram-positive and Gram-negative bacteria, mycobacteria, malaria pigment, and the pro- inf...

Ngày tải lên: 13/08/2014, 18:22

2 182 0
Báo cáo Y học: Introducing Wilson disease mutations into the zinc-transporting P-type ATPase ofEscherichia coli The mutation P634L in theÔhingeÕ motif (GDGXNDXP) perturbs the formation of the E2P state pdf

Báo cáo Y học: Introducing Wilson disease mutations into the zinc-transporting P-type ATPase ofEscherichia coli The mutation P634L in theÔhingeÕ motif (GDGXNDXP) perturbs the formation of the E2P state pdf

... haracteristics. They retain 37% and 23% of the wild-type A TPase activity, respectively, and are poorly phosphorylated by ATP and P i . Low but significant ATPase activity and phosphorylation by ... 3. Normalized zinc-dependent ATPase activity of the wild-type and mutated enzymes. TheATPaseactivity(percentageoftheactivityofthe wild-type) present in membranes shown. T...

Ngày tải lên: 17/03/2014, 17:20

8 500 0
w