Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx

... 98:5306-5311. 41. Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchi- yama Y, Sumi K, Iguchi H, Ito S, Doi T, Hamakubo T, Naito M, Auwerx J, ... the hepatocyte and protects the normal paren- chyma against liver injury [32]. Jak2 participates in transduc- tion of interleukin (IL)6 signaling in case of acu...

Ngày tải lên: 14/08/2014, 08:20

14 384 0
Báo cáo y học: "Asháninka medicinal plants: a case study from the native community of Bajo Quimiriki, Junín, Peru." doc

Báo cáo y học: "Asháninka medicinal plants: a case study from the native community of Bajo Quimiriki, Junín, Peru." doc

... giganteum Fabaceae: Inga sp. Maranthaceae: Calathea sp. Onagraceae: Ludwigia peploides Headache 15% Anacardiaceae: Tapirira guianensis Araceae: Anthurium dombeyanum Asteraceae: Mikania micrantha Campanulaceae: ... purify the body Bd ❧✦ Platano Musa paradisiaca Musaceae Wounds, haemorrhage Sa ❧✦ Pepa de palta Persea americana Lauraceae Diarrhoea Cbd ’Okilia’ ‒‒Eye infection Cs ❧✦ Achiote Bix...

Ngày tải lên: 10/08/2014, 09:21

23 1.5K 0
Báo cáo y học: " Fetal bone as a foreign body in the urinary bladder: a case report" pot

Báo cáo y học: " Fetal bone as a foreign body in the urinary bladder: a case report" pot

... Surgery, Madina Teaching Hospital, Faisalabad, Pakistan; Saadia Hameed of the Department of Pathology, Madina Teach- ing Hospital and University Medical College Faisalabad, Pakistan; and Rana Qaiser ... report and any accompanying images. A copy of the written consent is available for review by the Editor -in- Chief of this journal. Competing interests The authors declare th...

Ngày tải lên: 11/08/2014, 14:20

3 359 0
Báo cáo y học: Esterified Hyaluronic Acid and Autologous Bone in the Surgical Correction of the Infra-Bone Defects"

Báo cáo y học: Esterified Hyaluronic Acid and Autologous Bone in the Surgical Correction of the Infra-Bone Defects"

... mesially, buccally, distally, and lingually. Data were obtained at baseline before treatment and at 10 days, and 6,9, and 24 months after treatment. Surgical Technique After local anaesthesia, ... This characteristic is largely responsible for the consistency of the active component that can act as a barrier to the spread of any bacteria penetrating the tissues includin...

Ngày tải lên: 03/11/2012, 11:35

7 769 0
Báo cáo y học: "Enhanced glutamate, IP3 and cAMP activity in the cerebral cortex of Unilateral 6-hydroxydopamine induced Parkinson’s rats: Effect of 5-HT, GABA and bone marrow cell supplementation" ppsx

Báo cáo y học: "Enhanced glutamate, IP3 and cAMP activity in the cerebral cortex of Unilateral 6-hydroxydopamine induced Parkinson’s rats: Effect of 5-HT, GABA and bone marrow cell supplementation" ppsx

... intranigrally to substantia nigra individually and in combination on unilateral 6-hydroxydopamine induced Parkinson’s rat model was analyzed. Scatchard analysis of total glutamate and NMDA receptor ... treatment of PD. Glutamate neurotransmission plays an integral role in basal ganglia functioning especially in the striatum, where the balance of glutamate and dopamine is c...

Ngày tải lên: 10/08/2014, 05:21

10 456 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx

... differ in some details from that against dinuc- leotides [18,19]. The behaviour of a- sarcin against ApA as a function of pH, altogether with the characterization of the individual pK a values of the ... of RNase T1 [23,26,27] and His50 of a- sarcin [20] are involved in catalysis rather than in substrate binding. The role of Arg77 has not yet been establi...

Ngày tải lên: 31/03/2014, 23:20

7 434 0
Báo cáo y học: "WHO global campaigns: A way forward in addressing public health importance of common neurological disorders" ppt

Báo cáo y học: "WHO global campaigns: A way forward in addressing public health importance of common neurological disorders" ppt

... neurological disorders Aleksandar Janca* Address: School of Psychiatry and Clinical Neurosciences, University of Western Australia, Australia Email: Aleksandar Janca* - ajanca@cyllene.uwa.edu.au * ... the Interna- tional League Against Epilepsy (ILAE, a global profes- sional NGO) and the International Bureau for Epilepsy Published: 29 April 2004 Annals of General Hospital Psychiat...

Ngày tải lên: 08/08/2014, 20:23

2 354 0
Báo cáo y học: "Exome sequencing identifies a missense mutation in Isl1 associated with low penetrance otitis media in dearisch mice" pptx

Báo cáo y học: "Exome sequencing identifies a missense mutation in Isl1 associated with low penetrance otitis media in dearisch mice" pptx

... GATGCCCTGAGCAGAGAGG TGCAGAAAGCCAAACCTAGC Gm10859 2:5833494 AATCTCAGTTGAGAGAAAACCTACG GAGATAGCTCAGTCAGTCAGTCAGG Gm11149 9:49380322 GACATTCTCTAAAAGCAGAGACATCC ACGGACTACAGTCTAAAACATCTAAGC Gtf3c2 ... 7:110091057-8 AGAGGAAGTAGTACATAGGCTCATGG CTACTGAAAGAGTTAACTTAGTGGAGAGG Olfr749 14:51356853 AGACAGAATGTTGGCTAGTATGTTAGG CTAATTATCTAGATCGCCTTTGACTCC Rsf1 7:104809403-4 GACACTAAAAGTAGAAAGCAGTCACC GCTTTT...

Ngày tải lên: 09/08/2014, 23:20

19 319 0
Báo cáo y học: "Antiretroviral therapy at a district hospital in Ethiopia prevents death and tuberculosis in a cohort of HIV patients." ppt

Báo cáo y học: "Antiretroviral therapy at a district hospital in Ethiopia prevents death and tuberculosis in a cohort of HIV patients." ppt

... total lymphocyte count (TLC) in predicting mortality in both the pre-HAART and the HAART groups. Anaemia, history of prolonged fever, history of easy fatigability, history of tuberculosis, and the ... when HAART was introduced. A protease inhibitor-containing HAART reduced mortality by 64% in an Italian cohort [8]. Similarly, a multicenter HAART trial reported a 62% de...

Ngày tải lên: 10/08/2014, 05:20

8 324 0
w