Báo cáo y học: "CONTRAST: a discriminative, phylogeny-free approach to multiple informant de novo gene prediction" ppt

... predic- Start and stop codon classifier accuracy increases as informants are addedFigure 1 Start and stop codon classifier accuracy increases as informants are added. The graph shows the generalization ... increases as informants are added. The graph shows the generalization accuracy of CONTRAST's donor and acceptor splice site classifiers as more informants are added. The x-axis lab...

Ngày tải lên: 14/08/2014, 08:20

... the earliest demonstrators of the practicality of HIV and its family as gene vectors where do you think this area of research will go and will it develop into mainstream medicine? JS. It's ... Bill taught me the power of rigorous thinking to reveal answers and clarify murky research areas. AMLL. You clearly have enormous enthusiasm for your work. What is it about science that keeps y...

Ngày tải lên: 13/08/2014, 09:20

... are beyond the scope of the present paper and have to await future investigation. Feasibility of the approach To apply the approach outlined above to an experimental situation, one has to realize, ... Henry DI Abarbanel 2 Address: 1 Max-Planck-Institute of Neurobiology, Martinsried, Germany and 2 Department of Physics and Marine Physical Laboratory (Scripps Institution of Ocean...

Ngày tải lên: 13/08/2014, 16:21

... double-stranded DNA genome of approximately 5 kb. It has been well established that many polyomaviruses are able to transform mammalian cells [14]. The best- characterized polyomavirus, SV40, was originally ... animal cancers. Polyomavirus family members are known to have two other T antigen proteins with transforming ability. MCPyV is predicted to express a small T antigen that is ab...

Ngày tải lên: 14/08/2014, 08:21

... relevant to the rules here. The overall sum of all the nodes is +0.803, a confident score indicating that this is predicted to be a binding site. AACAGGAATA ATCAAGACAT TTCACGAATG …… …… ACGTCGATAC Binding ... straightforward static sampling over such a large dataset may result in a significant loss of infor- mation and a potentially biased classifier. A standard boost- ing alg...

Ngày tải lên: 14/08/2014, 17:22

... different array locations decreases spatial artifacts. We developed a new normalization method to deal with the spatial artifacts specific to functional protein microarrays. By assuming that signal ... particularly applicable to functional protein microarrays in comparison to antibody arrays, and, therefore, the normalization techniques used for DNA microarrays are usually not direc...

Ngày tải lên: 14/08/2014, 17:22

... M, Abeygunawardena N, Coulson R, Farne A, Holloway E, Kolesnykov N, Lilja P, Lukk M, Mani R, Rayner T, Sharma A, William E, Sarkans U, Brazma A: ArrayEx- press - a public database of microarray ... framework DISTILLER to a combination of publicly available microarray data and regulatory motif data. This allowed us to considera- bly extend the transcriptional network with novel inte...

Ngày tải lên: 14/08/2014, 21:20

... Machine trans- lation with a stochastic grammatical channel. In Proceedings of ACL’98, pages 1408–1414, Mon- treal, Canada. Kenji Yamada and Kevin Knight. 2001. A syntax- based statistical translation ... Global Age. John Benjamins Publishers. Tony Veale and Andy Way. 1997. Gaijin: A template-based bootstrapping approach to example- based machine translation. In Proceedings of “New...

Ngày tải lên: 17/03/2014, 07:20

... [http://www.fda.gov/Food/ FoodIngredientsPackaging/GenerallyRecognizedasSafeGRAS/ GRASSubstancesSCOGSDatabase/default.htm]. 25. Burdock GA, Carabin IG: Generally recognized as safe (GRAS): history and description. ... gelling agent (generally from 0.5% to 40%) to achiev e a viscosity range fr om fluid to gel and placed on storage at 22°C and 40°C. An antioxidant was added to mixture...

Ngày tải lên: 10/08/2014, 05:22

... CCAGTAAAATTAAAaCCAGGAATG 2 9, 10 60 (9) 74 (10) 208 h CCAGTAAAATTAAAGCCAGGAATG 3 9, 10 926 (9) 1267 (10) 3448 CCAGTAAAATTgAAGCCAGGAATG 2 9, 10 48 (9) 77 (10) 202 r 2702-2725 GCCTGAAAATCCcTACAATACTCC ... 229 GCCTGAAAAcCCATACAATACTCC 5 2,9 4 (2) 62 (9) 66 n 2333-2356 AGCAGATGATACAGTAgTAGAAGA 6 1,2,3,4,5,6 10 (1) 18 (6) 85 AGCAGATGATACAGTgTTAGAAGA 6 1,2,3,4,5,6 23 (1) 33 (4,6) 174 AGCAGATGATACAG...

Ngày tải lên: 11/08/2014, 21:21