Báo cáo y học: " Transcriptional profiling of MnSOD-mediated lifespan extension in Drosophila reveals a species-general network of aging and metabolic genes" pot

Báo cáo y học: "Transcriptional profiling of bovine intervertebral disc cells: implications for identification of normal and degenerate human intervertebral disc cell phenotypes" pdf

Báo cáo y học: "Transcriptional profiling of bovine intervertebral disc cells: implications for identification of normal and degenerate human intervertebral disc cell phenotypes" pdf

... TCTACCGCTGCGAGGT GAT TGTAATGGAACACGAT GCCTTT Versican VCAN NM_004385.4 GCCTTTCCTATCACCTC GAGAA CACGGCAACCCAAAAT GACT Collagen, type II, alpha 1 COL 2A1 NM_001844.4 GGAAGAGTGGAGACT ACTGGATTGAC TCCATGTTGCAGAAAA CCTTCA Synaptosomal ... sialoprotein IBSP NM_174084.2 GACAGCTATGATGGTC AAGATTACTACA TGGGTGAACTCATCCC AGTCT Tenomodulin TNMD NM_001099948.1 TCTGGCGTGACGGGTC TT AAAAAAGGCATTGAA CAAAACGA...

Ngày tải lên: 12/08/2014, 11:23

20 313 0
Báo cáo y học: "Transcriptional profiling of the nucleus pulposus: say yes to notochord" pptx

Báo cáo y học: "Transcriptional profiling of the nucleus pulposus: say yes to notochord" pptx

... pulposus in young animals, including humans [2,4]. It has also been proposed that most of these cells gradually disappear during aging [2,4] and are replaced by endplate chondrocytes or inner annulus ... Research &  erapy, Minogue and colleagues [1] used transcriptional profi ling to examine the phenotypic characteristics of bovine intervertebral disc cells and provi...

Ngày tải lên: 12/08/2014, 12:20

2 291 0
Báo cáo y học: " Transcriptional profiling of inductive mesenchyme to identify molecules involved in prostate development and disease" ppsx

Báo cáo y học: " Transcriptional profiling of inductive mesenchyme to identify molecules involved in prostate development and disease" ppsx

... Rhodes DR, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T, Pandey A, Chinnaiyan AM: ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia 2004, 6:1-6. 56. ... Peltola M, Autio R, Neal D, Wasylyk B, et al.: Integrated DNA/RNA micro- array profiling of hormone-refractory clinical prostate can- cers and metastases indicates deregulation...

Ngày tải lên: 14/08/2014, 08:20

14 286 0
Báo cáo y học: " Transcriptional profiling of MnSOD-mediated lifespan extension in Drosophila reveals a species-general network of aging and metabolic genes" pot

Báo cáo y học: " Transcriptional profiling of MnSOD-mediated lifespan extension in Drosophila reveals a species-general network of aging and metabolic genes" pot

... (5'-TGCAGTC- GAATAAAACGCAGATATGTTCG-3') and MnSOD2R (5'- TTAACCATGGTTAAATAATCGGCGTTGAA-3'). Both prod- ucts were generated using pfu DNA polymerase (Stratagene, San Diego, CA, USA). Products ... MnSOD-1 was generated using primers Mn1F (5'GTCGAATAAAACGCAGATATGTTCG-3') and Mn1R (5'- CCATGGTTAAATAATCGGCGTTGAA-3'). MnSOD-2 was generated using primers M...

Ngày tải lên: 14/08/2014, 08:20

27 258 0
Báo cáo y học: " Transcriptional profiling reveals barcode-like toxicogenomic responses in the zebrafish embryo" pptx

Báo cáo y học: " Transcriptional profiling reveals barcode-like toxicogenomic responses in the zebrafish embryo" pptx

... a spot and array level. Spots ideally have a diameter of 100 μm. Diameters less than 70 μm and greater than 140 μm are indicative of scratches and printing problems and the corresponding data ... of genes, and presumably also responses to environmental toxicants, can vary dramatically between indi- viduals. In a systematic study of variation in gene expression in...

Ngày tải lên: 14/08/2014, 08:20

17 254 0
Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

Báo cáo Y học: Hemocyanin from the keyhole limpet Megathura crenulata (KLH) carries a novel type of N-glycans with Gal(b1–6)Man-motifs doc

... in analytical scale. The four oligosaccharide fractions were separately pyridylaminated and designated endoH-PA, PNGaseF-PA, PNGaseA-PA and Hyd(HFA)-PA, respect- ively. Analytical anion-exchange ... Sigma (Deisenhofen, Germany). Peptide-N 4 -(N-acetyl-b-glucosaminyl)asparagine amidase A from almond (PNGase A) was from Seikagaku (Tokyo, Japan) and b-galactosidase from jack beans was...

Ngày tải lên: 31/03/2014, 08:20

15 482 0
Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc

Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc

... were as follows: 1. IL-4, CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG and CAGTGATGAGGACTTGGACTCATTCATGGTGC. 2. TGF-β1, TGGACCGCAACAACGCCATCTATGA- GAAAACC and TGGAGCTGAAGCAATAGTTGGTATC- CAGGGCT. 3. β-actin, ... obtained from the Shizuoka Laboratory Animal Center (Hamamatsu, Shizuoka, Japan). All mice were maintained in a pathogen-free facility at the Hyogo College of Medicine (Nishinomiya, Hyog...

Ngày tải lên: 09/08/2014, 08:22

7 399 0
Báo cáo y học: " Numbers needed to treat calculated from responder rates give a better indication of efficacy in osteoarthritis trials than mean pain scores" pptx

Báo cáo y học: " Numbers needed to treat calculated from responder rates give a better indication of efficacy in osteoarthritis trials than mean pain scores" pptx

... Max MB: Use of the cumulative propor- tion of responders analysis graph to present pain data over a range of cut-off points: making clinical trial data more understandable. J Pain Symptom Manage ... to at least 90%. The numbers and per- centages of patients achieving, say, at least 50% pain relief from baseline, might be defined as a responder, and presenta- tion of data in...

Ngày tải lên: 09/08/2014, 10:23

5 317 0
Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

Báo cáo y học: "Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect" pdf

... analysis of cartilage repair by synovial mesenchymal stem cell transplantation in rabbitsIn vivo analysis of cartilage repair by synovial mesenchymal stem cell transplantation in rabbits. (a) ... defects. Mesenchymal stem cells (MSCs) are an attractive cell source for cartilage regenerative medicine because they can be har- vested in a minimally invasive manner, are easily isolat...

Ngày tải lên: 09/08/2014, 10:23

10 470 0
Báo cáo y học: "Trends towards an improved disease state in rheumatoid arthritis over time: influence of new therapies and changes in management approach: analysis of the EMECAR cohort" ppt

Báo cáo y học: "Trends towards an improved disease state in rheumatoid arthritis over time: influence of new therapies and changes in management approach: analysis of the EMECAR cohort" ppt

... hemoglobin, alkaline phosphatase, body mass index and the DAS28-3, the HAQ score and the Larsen score at baseline. Bivariate analysis was performed with all factors and covari- ates, and then backward stepwise ... Gerards AH, Landewe RB, Prins AP, Bruyn GA, Goei The HS, Laan RF, Dijkmans BA: Cyclosporin A monotherapy versus cyclosporin A and methotrexate combination therapy in...

Ngày tải lên: 09/08/2014, 13:22

10 426 0
Từ khóa:
w