Báo cáo y học: " Diversity and evolution of phycobilisomes in marine Synechococcus spp : a comparative genomics stud" docx
Báo cáo y học: " Diversity and evolution of phycobilisomes in marine Synechococcus spp.: a comparative genomics stud" docx
... Physiologists; 198 8:1 02-121. 18. Ong LJ, Glazer AN: Phycoerythrins of marine unicellular cyanobacteria. I. Bilin types and locations and energy trans- fer pathways in Synechococcus spp. phycoerythrins. J ... activity of a phycobiliprotein lyase: both the attachment of phycocyanobilin and the isomerization to phycoviolobilin are catalyzed by the pro- teins PecE and...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Efficacy and safety of aripiprazole in the treatment of bipolar disorder: a systematic review" pdf
... approval of quetiapine and the olanzapine-fluoxetine combination against acute bipolar depression and the approval of olanzapine, quetiapine and aripiprazole for the maintenance phase. This is an important ... pharmacology, clinical efficacy, and tolera- bility. Clin Ther 2004, 2 6:6 49-666. 60. Caccia S: N-dealkylation of arylpiperazine derivatives: disposi- tion and metabo...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Expression and regulation of CCL18 in synovial fluid neutrophils of patients with rheumatoid arthritis" potx
... microarray data, semiquantitative RT-PCR was performed with the same RNAs as used in the microarray analysis of four randomly selected RA patients (namely nos 1, 2, 7 and 8) and one of the healthy donors ... Vingron M: Parameter estimation for the calibration and variance stabili- zation of microarray data. Stat Appl Genet Mol Biol 2003, 2:Article3. 26. Database for Annotation,...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "Expression and regulation of neurotrophins in the nondegenerate and degenerate human intervertebral disc" pdf
... the majority of the laboratory work and analysis, and drafted the manuscript. AJF helped to secure funding, participated in the design of the study and interpretation of data, and assisted in the ... and BDNF, factors that may influence and enhance innervation and pain in the degenerate IVD. Expression of Trk -A and Trk-B by cells of the nondegenerate and de...
Ngày tải lên: 09/08/2014, 11:20
Báo cáo y học: "Presentation and management of keloid scarring following median sternotomy: a case study" doc
... 33(11 ):1 291-302. 10. Alster TS, Tanzi EL: Hypertrophic scars and keloids: etiology and management. Am J Clin Dermatol 2003, 4(4 ):2 35-43. 11. Mofofikyo BO, Adeyemo WL, Abdus-salam AA: Keloid and hypertrophic scars: ... management of keloid scarring following median sternotomy: a case study Rikesh Patel, Sotiris C Papaspyros * , Kalyana C Javangula, Unnikrishnan Nair Abstract...
Ngày tải lên: 10/08/2014, 09:23
Báo cáo y học: " Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR" pot
... nM HPVE1F1 ANANGCTGTGCAKGNNCTAAAACGAAG 300 nM HPVE1R1 AGTTTCCACTTCAGTATTGCCATA 300 nM HAPBF TGAAGGTGGAGGACATTCCTCTA 400 nM HAPBR CTGGAATTGCGATTTCTGGTAA 400 nM HAPBprobe Cyan500-CGAGAATCACCCTGCCAGACTTCCGT-BBQ ... nM HPV16L1probe 6FAM-GTCATTATGTGCTGCCATATCTACTTC-TAMRA 400 nM HP18L1F GCATAATCAATTATTTGTTACTGTGGTAGATACCACT 400 nM HP18L1R GCTATACTGCTTAAATTTGGTAGCATCATATTGC 400 nM HPV18L1probe HEX-A...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot
... E, Gaillard D: Quantitative analysis of inflammatory cells infiltrating the cystic fibrosis airway mucosa. Clin Exp Immunol 2001, 124(1 ):6 9-76. 35. Livraghi A, Randell SH: Cystic fibrosis and ... the initiation and amplifi- cation of the coagulation cascade and furthermore they play a pivotal role in thrombosis, in the propagation of inflammation, modulation of vasc...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: " Level and course of FEV1 in relation to polymorphisms in NFE2L2 and KEAP1 in the general population" pps
... Morishima Y, Kimura T, Kiwamoto T, Iizuka T, Hegab AE, Hosoya T, Nomura A, Sakamoto T, Yamamoto M, Sekizawa K: Transcription factor Nrf2 plays a pivotal role in protection against elastase-induced ... by a single allele of any SNP (table 3). Similarly, 2 haplotypes in KEAP1 (haplotypes A and B) were unique (table 3). NFE2L2 and KEAP1 variations and level of FEV 1 SNP rs2...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: "Effectiveness and safety of adalimumab in patients with ankylosing spondylitis or psoriatic arthritis and history of anti-tumor necrosis factor therapy" pdf
... clinical trials. Abbreviations ACR: American College of Rheumatology; AS: ankylosing spondylitis; ASAS: Assessment of SpondyloArthritis International Society; BASDAI: Bath Ankylos- ing Spondylitis Disease ... "other." Descriptive analyses were performed by calculating counts and percentages for qualitative data and by calcu- lating means, standard deviations, medians, and...
Ngày tải lên: 12/08/2014, 14:22
Báo cáo y học: "Efficacy and safety of tiotropium in COPD patients in primary care – the SPiRiva Usual CarE (SPRUCE) study" ppsx
... from AstraZeneca, BI and GSK. Daryl Freeman receives funding for a clinical post from AstraZeneca, BI and GSK and has recently been funded to attend an international conference by Altana. Angela ... data and data following multiple doses of randomised treatment – for PFT and diary cards (DIARY). Missing data due to worsening of COPD were imputed using the least favourable data...
Ngày tải lên: 12/08/2014, 15:20