Báo cáo y học: " Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the" ppt

Báo cáo y học: " Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the" ppt

Báo cáo y học: " Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the" ppt

... R218 Research Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the phytopathogen ... strain 8004 and investigated the genetic diversity and host specificity of Xcc by array-based comparative genome hybridization a...
Ngày tải lên : 14/08/2014, 08:20
  • 26
  • 322
  • 0
Báo cáo y học: "Comparative study on saponin fractions from Panax notoginseng inhibiting inflammation-induced endothelial adhesion molecule expression and monocyte adhesion" docx

Báo cáo y học: "Comparative study on saponin fractions from Panax notoginseng inhibiting inflammation-induced endothelial adhesion molecule expression and monocyte adhesion" docx

... ICAM-1 AGACACAAGCAAGAGAAGAA GAGAAGCCCAAACCCGTATG 234 NM_012967.1 VCAM-1 GGAGCCTGTCAGTTTTGAGAATG TTGGGGAAAGAGTAGATGTCCAC 105 NM_012889.1 GAPDH TGCACCACCAACTGCTTAG AGTGGATGCAGGGATGATGT 180 NM_017008 ... was prepared by a Milli-Q purification system (USA). Animals and treatment Male Sprague-Dawley rats (170±10g), purchased from Guangdong Provincial Medical Laboratory Animal Cente...
Ngày tải lên : 13/08/2014, 14:20
  • 37
  • 309
  • 0
Báo cáo y học: "Most recent developments in strategies to reduce the progression of structural changes in osteoarthritis: today and tomorrow" doc

Báo cáo y học: "Most recent developments in strategies to reduce the progression of structural changes in osteoarthritis: today and tomorrow" doc

... disease-modifying potential of these agents in OA. Intra-articular treatments: steroids and hyaluronic acid The pain and secondary inflammation in OA can be effectively relieved by intra-articular ... hyaluronic acid treatment. A local disease such as knee OA may mandate a local therapy such as intra-articular injections. Only one study has looked at the long-term impact of repeti...
Ngày tải lên : 09/08/2014, 07:20
  • 14
  • 420
  • 0
Báo cáo y học: " Improved vaccine protection against retrovirus infection after co-administration of adenoviral vectors encoding viral antigens and type I interferon subtypes" ppsx

Báo cáo y học: " Improved vaccine protection against retrovirus infection after co-administration of adenoviral vectors encoding viral antigens and type I interferon subtypes" ppsx

... necrosis factor alpha (TNF -a) and either PerCP-anti-CD8 or PerCP-anti-CD4 (all from Becton Dickinson, Heidelberg, Germany) and analyzed by flow cytometry. Statistical analyses Statistical analyses ... efficacy of replicase-based DNA vaccines. Vaccine 2006, 24:5110-5118. 31. Day SL, Ramshaw IA, Ramsay AJ, Ranasinghe C: Differential effects of the type I interferons alpha4, beta, and...
Ngày tải lên : 13/08/2014, 01:21
  • 15
  • 277
  • 0
Báo cáo y học: " Drug metabolizing enzyme activities versus genetic variances for drug of clinical pharmacogenomic relevance" pot

Báo cáo y học: " Drug metabolizing enzyme activities versus genetic variances for drug of clinical pharmacogenomic relevance" pot

... that may or may not affect catabolic rates. For many genes, there are a large number of variants. It is not practical or necessary to phenotypically characterize each variant, and only polymorphisms ... used clinical practice today. CYP 2D6 hydroxylates aromatic rings or an accompanying short side-chain of basic aryl-alkyl amines containing a protonated nitrogen. Of all enzymes...
Ngày tải lên : 13/08/2014, 13:20
  • 9
  • 262
  • 0
Báo cáo y học: " Using Geographic Information Systems (GIS) to assess the role of the built environment in influencing obesity: a glossary" pptx

Báo cáo y học: " Using Geographic Information Systems (GIS) to assess the role of the built environment in influencing obesity: a glossary" pptx

... specific walkable land uses (e.g. parks) may be more important than hav- ing equal amounts of different land uses in an area [63]. GIS enables the integration of land use data from a range of sources ... theo- retically-informed rather than data-driven analytical approaches [75]. Acknowledgements LT is currently supported by an Australian National Health and Medical Research Council...
Ngày tải lên : 14/08/2014, 08:20
  • 9
  • 423
  • 0
Báo cáo y học: "Comparative genomics reveals a constant rate of origination and convergent acquisition of functional retrogenes in Drosophila" pptx

Báo cáo y học: "Comparative genomics reveals a constant rate of origination and convergent acquisition of functional retrogenes in Drosophila" pptx

... Assembly/Alignment/Annotation of 12 related Drosophila species: Comparative Analysis Freeze 1 [http://rana.lbl.gov/ drosophila] 48. Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanati- des ... MA: Conservation of intron position indicates separation of major and variant H2As is an early event in the evolution of eukaryotes. J Mol Evol 1990, 30:449-455. 15. Zhang Z, Inoma...
Ngày tải lên : 14/08/2014, 17:22
  • 9
  • 406
  • 0
Báo cáo y học: "Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes" pot

Báo cáo y học: "Comparative genomics reveals 104 candidate structured RNAs from bacteria, archaea, and their metagenomes" pot

... Enterococcus faecium RF01760 Transposase-resistance ? y n Several phyla TwoAYGGAY y n n Human gut, g-Proteobacteria, Clostridiales wcaG Y y y Marine, cyanophage RF01761 Whalefall-1 Y n n Whalefall only RF01762 yjdF ... linkage geometry and the stability of RNA. RNA 1999, 5:1308-1325. 28. Ueland PM: Pharmacological and biochemical aspects of S -adenosylhomocysteine and S-ad...
Ngày tải lên : 09/08/2014, 20:21
  • 17
  • 361
  • 0
Báo cáo y học: "Comparative genomics reveals birth and death of fragile regions in mammalian evolutio" pdf

Báo cáo y học: "Comparative genomics reveals birth and death of fragile regions in mammalian evolutio" pdf

... (for adjacent branches like M+ and R+), green (for branches that are separated by a single branch like M+ and D+ separated by MR+), and yellow (for branches that are separated by two branches ... same way as the Nadeau-Taylor ‘exponential length distribution test’ was applied in numerous papers. The Nadeau-Taylor test typically amounted to constructing a histogram of synteny block...
Ngày tải lên : 09/08/2014, 22:23
  • 15
  • 384
  • 0
Báo cáo y học: "Comparative genomics of the social amoebae Dictyostelium discoideum and Dictyostelium purpureum" ppt

Báo cáo y học: "Comparative genomics of the social amoebae Dictyostelium discoideum and Dictyostelium purpureum" ppt

... AGTTCCTTCATTCT AAGAAAACC TCCGTCAAC Dd_r28 GTTGACCTTACAGCAATCTAATC ACAAATTTTTACTTCAC AAAAAAAAAACCCCTTCGTCAAC Dd_r41 GTTGACCTTACAGCAAATCTTAA AGCTACTTCATTCT AAGAAAAAC TCCTGTCAAC Dd_r47 GCTGACCTTACAGCAATTCTATC ... ATTCAAAATTTAAC TCTGAAAT CTTGAATTC Dp_11 GAATTCCTTACAGCAATTAAACT C ATTCAAAATTTAAC TCTGAAAT CTCGAATTC Dp_19 GAATTCCTTACAGCAATAAACTT GACTCTGAAATCTT AAATTC Dp_2 GAATTCCTTACAGCAATTA-CAT TATT...
Ngày tải lên : 09/08/2014, 22:23
  • 23
  • 481
  • 0
Từ khóa: