0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot

Báo cáo y học:

Báo cáo y học: " Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen" doc

... supplementation to maintain an optimalplasma 25-(OH)D concentration above 30 ng/ml is aninexpensive and a safe measure as vitamin D t oxicity isonly observed at plasma 25-(OH)D concentration higherthan ... Efficacy and safety of tenofovir DFvs stavudine in combination therapy in antiretroviral-naive patients: a 3-year randomized trial. JAMA 2004,292:191-201.31. Amorosa V, Tebas P: Bone disease and ... distribution, andreproductio n in any medium, provided the original work is properly cited.Statistical analysisAll statistical analyses were performed with STATA andR software. Pre-HAART data was...
  • 6
  • 398
  • 0
Báo cáo y học:

Báo cáo y học: "Egress of HSV-1 capsid requires the interaction of VP26 and a cellular tetraspanin membrane protein" doc

... respectively:5'-GGATCCCGCAG GCC A A AG AC A AC A ATAG TGGTGCCAGTCAAGAGCTGGCACCACTATTGTTGTCTTTGGCCTGtcgtcagctcgtgccgtaagTGAA AC TAGT TACCAGATCATAACAACCCTCAAGAGG GTTGT TATGATC TGGTAACTAGTT TCATTTTTTCTAGA-3' ... 5'-AGGCATGCCCATTGTTATCTG -3' and 5'- GAGA-CAATCGCGAACATCTAC -3', 5'- ATTCCACCCGCATGGAGTTC -3' and 5'- CGGTGATGTTCGTCAG-GACC -3', respectively. Reactions were run in a 96-wellformat ... proteinand a human embryonic lung mRNA library as the target(Supplementary Table 1). These interactions were furtherconfirmed by a β-gal activity assay (Fig. 1a) . One of theVP26 interacting...
  • 12
  • 302
  • 0
Báo cáo y học:

Báo cáo y học: "Chiropractic and self-care for back-related leg pain: design of a randomized clinical trial" docx

... who qualifyand agree to participate are scheduled for a secondbaseline evaluation to occur within 7-14 days. Chiro-practic and allopathic practitioners participate in patientexaminations and ... and axial planes and (2)average velocities in the sagittal, coronal, and axialplanes from neutral to end ranges.Standing Postural SwayPostural sway data are collected using a method andprotocol ... S, Anderson AV: A pilot study for a randomizedclinical trial assessing chiropractic care, medical care, and self-careeducation for acute and subacute neck pain patients. J ManipulativePhysiol...
  • 14
  • 377
  • 0
Báo cáo y học:

Báo cáo y học: "Hybrid dynamic/static method for large-scale simulation of metabolism" pptx

... metabolismKatsuyuki Yugi†, Yoichi Nakayama*†, Ayako Kinoshita and Masaru TomitaAddress: Institute for Advanced Biosciences, Keio University, Fujisawa, Kanagawa, 252–8520, Japan.Email: Katsuyuki Yugi ... chaos@sfc.keio.ac.jp; Yoichi Nakayama* - ynakayam@sfc.keio.ac.jp; Ayako Kinoshita - ayakosan@sfc.keio.ac.jp; Masaru Tomita - mt@sfc.keio.ac.jp* Corresponding author †Equal contributorsAbstractBackground: ... dynamic properties ofthe pathway. We have evaluated the accuracy of the hybrid method in comparison to a classical dynamic kinetic sim-ulation using small virtual pathways and an erythrocytemetabolism...
  • 11
  • 336
  • 0
Báo cáo y học:

Báo cáo y học: "High resolution transcriptome maps for wild-type and nonsense-mediated decay-defective Caenorhabditis elegans." potx

... elegans, in particu-lar in the analysis of splicing and RNA stability.Materials and methodsStrain maintenance and RNA preparation and processingC. elegans strains were maintained on NGM agar ... openreading frame strongly inhibits translational initiation andgreatly accelerates mRNA degradation in the yeast Saccha-romyces cerevisiae. J Biol Chem 1995, 270:8936-8943.25. Pulak R, Anderson ... level (Table S5 in Additionaldata file 1) and at the level of transfrags (Table S6 in Addi-tional data file 1), confirming the accuracy of all datasets.Novel transfrags can either arise from...
  • 18
  • 313
  • 0
Báo cáo y học:

Báo cáo y học: "Pharmacoproteomic study of the effects of chondroitin and glucosamine sulfate on human articular chondrocyte" pot

... 5'-CACCCAGGT-CAAACACCAG-3'; HPRT1 forward, 5'-TGACCTT-GATTTATTTTGCATACC-3'; HPRT1 reverse, 5'-CGAGCAAGACGTTCAGTCCT-3'; RPLP0 forward, 5'-TCTACAACCCTGAAGTGCTTGAT-3', ... asfollows: SOD2 forward, 5'-CTGGACAAACCTCAGC-CCTA-3'; SOD2 reverse, 5'-TGATGGCTTCCAG-CAACTC-3'; GRP78 forward, 5'-GGATCATCAACGAGCCTACG-3'; GRP78 reverse, 5'-CACCCAGGT-CAAACACCAG-3'; ... Effects of chondroitin and glucosamine sulfate in a dietary bar formulation on inflammation, interleukin-1beta, matrix metalloprotease-9, and cartilage damage in arthritis. Exp Biol Med (Maywood)...
  • 12
  • 351
  • 0
Báo cáo y học:

Báo cáo y học: "CellProfiler: image analysis software for identifying and quantifying cell phenotypes" potx

... currently analyze each slice of a time-CellProfiler analysis of a Forkhead (FOXO 1A) cytoplasm-nucleus translocation assayFigure 4CellProfiler analysis of a Forkhead (FOXO 1A) cytoplasm-nucleus translocation ... introduction, in that it contains:advanced algorithms for image analysis that are able to accu-rately identify crowded cells and non-mammalian cell types; a modular, flexible design allowing analysis ... DNA or protein staining).RationaleExamining cells by microscopy has long been a primary method for studying cellular function. When cells are stainedappropriately, visual analysis can reveal...
  • 11
  • 453
  • 0
Báo cáo y học:

Báo cáo y học: " Genome-wide investigation of in vivo EGR-1 binding sites in monocytic differentiation" doc

... Forrest A, Van Nimwegen E,Daub C, Balwierz P, Irvine K, Lassman T, Ravasi T, Hasegawa Y, deHoon M, Katayama S, Schroder K, Carninci P, Tomaru Y, Kanamori-Katayama M, Kubosaki A, Akalin A, Ando Y, ... respectively. TheDNA samples were recovered by phenol:chloroform:isoamylalcohol extraction or QIAquick PCR purification kit (Qiagen,Valencia, CA, USA).LM-PCR, array hybridization and analysis of Affymetrix ... further analysis.Co-localization of EGR-1 with histone acetylation and transcription start sites Comparison of ChIP-chip data of EGR-1 with FANTOM4 datasets (see Materials and methods) revealed...
  • 14
  • 206
  • 0
Báo cáo y học:

Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot

... actual interaction variable may have several observa-tion variables if the pair appears in multiple assays. For thoseassays with binary observations, Tij.On is a binary variable andthe probability ... interaction assays. For these gold standard pairs, we fixed the value of the'actual interaction& apos; variable accordingly. In all other proteinpairs, we leave the actual interaction variables ... mostly post-translational modification motifs that appear across manyproteins. We removed motifs that are annotated as 'Composi-tionally biased' or 'DNA or RNA associated'....
  • 18
  • 251
  • 0
Báo cáo y học:

Báo cáo y học: "The Systemic Inflammatory Response Syndrome (SIRS) in acutely hospitalised medical patients: a cohort study"

... distribu-tion of the counting data.EpiData version 3.1 was used for data registration andSTATA version 8 (STATA Corporation®, Texas, USA) for statistical analysis.EthicsIn accordance with Danish ... epidemiological point of view, a system-atic registration of SIRS status in a patient arriving at a medical emergency ward may provide improved informa-tion for decision making in management of the patient.The ... 28-day mortality. SIRS symptomsprovide information on a patient with a highly activatedimmune response due either to infections or to other con-ditions, and a systematic registration of the symptomsmight...
  • 6
  • 698
  • 1

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ