Báo cáo y học: "Cross-species cluster co-conservation: a new method for generating protein interaction networks" docx
Báo cáo y học: "Cross-species cluster co-conservation: a new method for generating protein interaction networks" docx
... functional information
was available. While this is appropriate for method valida-
tion, the disadvantage is that there are problems with
annotation due in part to a lack of standardization, which
would ... functional relationships.
For any given method, there are advantages and disadvan-
tages. The number of false positives and false negatives is a
key measurement of accuracy. In...
Báo cáo y học: "Connecting the dots in Huntington’s disease with protein interaction networks" pptx
... therapies for HD, this complexity is
particularly daunting, as researchers will have to validate
individually the importance of many of these protein- protein
interactions by genetic or pharmacological ... pathogenesis.
The authors used a combination of library and matrix yeast
two-hybrid screens to place Htt within the context of an
interaction network. The yeast two-hybrid system tak...
Báo cáo Y học: Endogenous cardiac glycosides, a new class of steroid hormones pot
... 533–539.
29. Masugi, F., Ogihara, T., Hasegawa, T., Sagakuchi, K. & Kuma-
hara, Y. (1988) Normalization of high plasma level of ouabain-
like immunoreactivity in primary aldosteronism after removal ... adrenocortical tumor.
J. Hypertens. 10, S27.
32.Komiyama ,Y. ,Nishimura,N.,Munakata,M.,Okuda,K.,
Nishino,N.,Kosaka,C.,Masuda,M.,Mori,T.,Matsuda,T.&
Takahashi, H. (1999) Increases in pl...
Báo cáo Y học: Human sprouty 4, a new ras antagonist on 5q31, interacts with the dual specificity kinase TESK1 potx
... molecular mechanism of action of endogenous
sproutys clearly requires additional studies.
By performing a yeast two-hybrid analysis, using a
human fetal liver cDNA library and hspry4 as bait, we
aimed ... protein
concentrations as determined by BCA assay (Bio-Rad).
Yeast two-hybrid assay
Full-length human sprouty 4 cDNA was amplified by PCR
with forward primer 5¢-CTA
GTCGACATGCTCAGCC
CCC...
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
... cleavage was observed even when 100 ng
of the mutant variants were assayed. In addition, although
wild-type a- sarcin degrades polyadenylic acid on a zymo-
gram assay, R121K and R121Q did not cleave ... ribonuclease
activity of a- sarcin has been developed by using the
dinucleotide ApA as substrate [18]. Both mutant variants
hydrolysed ApA. They displayed a K
m
value similar to
that of...
Báo cáo y học: " Is interleukin-1 a good target for therapeutic intervention in intervertebral disc degeneration: lessons from the osteoarthritic experience" pdf
... Page 1 of 2
(page number not for citation purposes)
Available online http://arthritis-research.com/content/9/6/110
Abstract
IL-1 plays a key role in disc degeneration and could be a valid
target ... IL-1ra down-regulates metal-dependent proteases [4] and,
delivered directly or by gene therapy in explants of degenerated
human IVDs, almost completely eliminates enzyme activity,
thereby de...
Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf
... 182
Antisense: CACGATGCCTTTCACCACGAC
COL 2A1 Sense: GGAAACTTTGCTGCCCAGATG 710–876 167
Antisense: TCACCAGGTTCACCAGGATTGC
AGN, aggrecan; ALP, alkaline phosphatase; COL 2A1 , collagen type II α1; GAPDH, ... GAGATTTCTCTGTATGGCACC 1,457–1,732 276
Antisense: CTGCAAATGAGACACTTTCTC
PPAR
γ
Sense: TGAATGTGAAGCCCATTGAA 1,476–1,636 161
Antisense: CTGCAGTAGCTGCACGTGTT
Cartilage-specific genes
AGN Sense: T...
Báo cáo y học: "Aboriginal status is a prognostic factor for mortality among antiretroviral naïve HIV-positive individuals first initiating HAART" ppt
... for aboriginal in the univariate and multivariate
analyses ranged from 0.10 (cell recovery analysis) to 0.25
(mortality analysis), which indicates that misclassifica-
tion bias or residual confounding ... two
consecutive plasma HIV viral loads of < 500 copies/ml. In
these analyses Aboriginal status was not associated with
HIV plasma viral load response. The multivariate analysis
shows th...
