0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: "The DAVID Gene Functional Classification Tool: a novel biological module-centric algorithm to functionally analyze large gene lists" potx

Báo cáo y học:

Báo cáo y học: "The DAVID Gene Functional Classification Tool: a novel biological module-centric algorithm to functionally analyze large gene lists" potx

... of novel alternativealgorithms as a complement is still very necessary.The same data analyzed by the DAVID Gene Functional Classification ToolThe same gene list (Additional data file 1) was ... high-throughput functional analytical tools, will obvi-ously not work for the genes that lack annotation. A novel agglomeration method to classify a gene list into functionally related groups based on ... annotation data. Additional data file 12provides a hypothetical example to measure the relationshipsof gene- gene pairs by kappa statistics with annotationsorganized in a 'flat' matrix....
  • 16
  • 281
  • 0
Báo cáo y học:

Báo cáo y học: "Retinoid X receptor and peroxisome proliferator-activated receptor-gamma agonists cooperate to inhibit matrix metalloproteinase gene expression" potx

... prepa-ration, and statistical analysis and contributed equally to thiswork. YR was responsible for acquisition of data, analysis andinterpretation of data, and manuscript preparation. MBS wasresponsible ... nuclear receptor-associ-ated coactivator and corepressor activity by detectingchanges in histone acetylation. We have previously shown thatIL-1 leads to an increase in histone acetylation at ... acetyltransferases (HATs) [12]. HDAC activityresults in a decrease in histone acetylation and a subsequentdecrease in transcriptional activity, whereas HAT activity leads to an increase in histone...
  • 16
  • 384
  • 0
Báo cáo y học:

Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx

... levelsMouse plasma cytokine level analysis was performed atCytolab (Cytolab, Muelligen, Switzerland). A multiplexed parti-cle-based flow cytometric cytokine assay was used [47]. MAPFluorokine cytokine ... immunoreactivity whentested by affinity chromatography on an EDA-sepharose resin(data not shown) and displayed a biological activity compara-ble with that of recombinant human IL10 used in equimolaramounts ... shown to comprise biological active antibodyand cytokine moieties by binding assays on recombinant antigenand by MC/9 cell proliferation assays. We have alsocharacterized the ability of F8-IL10...
  • 15
  • 266
  • 0
Báo cáo y học:

Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx

... 268:17083-17095.18. Barak D, Kronman C, Ordentlich A, Ariel N, Bromberg A, Marcus D, Lazar A, Velan B, Shafferman A: Acetylcholinesterase peripheral anionic sitedegeneracy conferred by amino acid arrays sharing ... Camps P, Formosa X, Galdeano C, Go mez T, Mun oz-Torrero D,Scarpellini M, Viayna E, Badia A, Clos MV, Camins A: Novel Donepezil-BasedInhibitors of Acetyl- and Butyrylcholinesterase and Acetylcholinesterase-Induced ... NuclearEnergy Research. CC is a research fellow in the Depart-ment of Medical Research of Mackay Memorial Hospi-tal. HYL, WT, and YH are professors from NationalTaiwan University, National Taipei...
  • 13
  • 389
  • 0
Báo cáo y học:

Báo cáo y học: "The boy who refused an IV: a case report of subcutaneous clodronate for bone pain in a child with Ewing Sarcoma" pot

... use and by what route. Cancer-relatedbone pain is a particularly difficult symptom to treat.Bisphosphonates have gained acceptance as a standardapproach to bone pain in adults. In the idealized ... was 23 kg.He had multiple pain complaints including headache,back pain and generalized arthralgia/myalgia. There was a particularly troubling bone pain involving his forearms,wrists and hands ... to a combination of opiates, gabapentin and non-steroidal anti-inflammatorydrugs. Clodronate, a bisphosphonate, was added to the regimen to treat bone pain. It was givensubcutaneously every...
  • 4
  • 423
  • 1
Báo cáo y học:

Báo cáo y học: "The "incidental" episode of ventricular fibrillation: a case report." pdf

... Vereckei A: Pseudo-ventricular tachycardia: electrocardio-graphic artefact mimicking non-sustained polymorphic ven-tricular tachycardia in a patient evaluated for syncope. Heart2004, 90:81.4. Knight ... SA, Morady F: Physi-cian interpretation of electrocardiographic artifact thatmimics ventricular tachycardia. Am J Med 2001, 110:335-338."Ventricular fibrillation" – black dots mark ... lifetime."Sir Paul Nurse, Cancer Research UKYour research papers will be:available free of charge to the entire biomedical communitypeer reviewed and published immediately upon acceptancecited...
  • 2
  • 272
  • 0
Báo cáo y học:

Báo cáo y học: " The Scandinavian Solutions for Wellness study - a two-arm observational study on the effectiveness of lifestyle intervention on subjective well-being and weight among persons with psychiatric disorders" pot

... was defined as a decrease. All analyses werecomputed using SAS®9, SAS Institute Inc., SAS CampusDrive, Cary, North Carolina 27513, USA.ResultsParticipant characteristicsIn total, 373 participants ... factors diagnosis, duration of illness, psy-chotropic drug at baseline, sex, weight or CGI at baselinehad any effect.Waist circumference changes and associated factorsIn the initial analysis, ... SfWprogram in Scandinavia and the feedback from the SfWinstructors about the ability of the participants to fill inthe scale was positive.Table 3: Baseline factors associated with weight and waist...
  • 12
  • 348
  • 0
Báo cáo y học:

Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

... ACGTTGGATGAGAGAACTGGGTTAAGGCAGrev ACGTTGGATGCCAGCACATCTTTTCACTCCACTCCATACCACTGGTCAGCTG 93.81ST+7 rs574174 G /A 0.19 0.19 fwd ACGTTGGATGCTGCCCTTGATGATTCCAAGrev ACGTTGGATGGGAACATCACAGGAAATGACACTGTCCCCATCCCATC ... ACGTTGGATGTTGCTCAGCCCCAAAGATGGCCCCACAGCCACTGGACAG 93.95V4 rs2787094 C/G 0.22 0.23 fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCCrev ACGTTGGATGTATGGTTCGACTGAGTCCACCTGAGTCCACACTCCCCTG 93.84Respiratory ... ACGTTGGATGAGTCGGTAGCAACACCAGGrev ACGTTGGATGACCATGACACCTTCCTGCTGGCTGCCTCTGCTCCCAGG 91.88ST+4 rs44707 A/ C 0.41 0.41 fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGGrev ACGTTGGATGCCACTTCCTCTGCACAAATCACAAATCACCTCTGTCACCC...
  • 12
  • 355
  • 0
Báo cáo y học:

Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt

... ChangesinDNA,proteoglycan(sulfatedglycosaminoglycan) and hyaluronic acid content. Changes inDNA, proteoglycan (sulfated glycosaminoglycan (GAG)) andhyaluronic acid (HA) contents of the annulus fibrosus (AF) andnucleus ... human andmany large animal models. On the other hand, largeranimals, such as dog and sheep, are very expensive andnot appropriate to establish new experimental condi-tions, although they are ... longitudinally using a microtome to give 5 μm sections. The paraffin sections weredewaxed and stained with Safranin O to detect proteo-glycan (predominantly aggrecan).Statistical analysisStatistical...
  • 9
  • 402
  • 0
Báo cáo y học:

Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

... (the1Intensive Care Unit, Osaka University Hospital, Yamadaoka, Suita, Osaka 565,JapanFull list of author information is available at the end of the articleIzumi et al. Critical Care 1998, 2:79http://ccforum.com ... LETTERLetter to the EditorReiko Izumi RN1, Motomu Shimaoka MD, PhD1,2, Chiemi Nagaoka RN1, Masayasu Komaki RN1, Ayako Mizutani RN1,Myonsun Yoh PhD2, Takeshi Honda MD, PhD2, Nobuyuki Taenaka ... Ltd, Osaka Japan)was adjusted to supply antiseptic solution (residualchloride 20 ppm, pH 5.7, flowing at 61/min) for 15 s.This apparatus readily produces hypochlorous acidwhen used and is...
  • 2
  • 450
  • 0

Xem thêm

Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longThơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ