Báo cáo y học: "The DAVID Gene Functional Classification Tool: a novel biological module-centric algorithm to functionally analyze large gene lists" potx
Báo cáo y học: "The DAVID Gene Functional Classification Tool: a novel biological module-centric algorithm to functionally analyze large gene lists" potx
... of novel alternative algorithms as a complement is still very necessary. The same data analyzed by the DAVID Gene Functional Classification Tool The same gene list (Additional data file 1) was ... high-throughput functional analytical tools, will obvi- ously not work for the genes that lack annotation. A novel agglomeration method to classify a gene list into funct...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Retinoid X receptor and peroxisome proliferator-activated receptor-gamma agonists cooperate to inhibit matrix metalloproteinase gene expression" potx
... prepa- ration, and statistical analysis and contributed equally to this work. YR was responsible for acquisition of data, analysis and interpretation of data, and manuscript preparation. MBS was responsible ... nuclear receptor-associ- ated coactivator and corepressor activity by detecting changes in histone acetylation. We have previously shown that IL-1 leads to an increase in histone...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo y học: "Preclinical characterization of DEKAVIL (F8-IL10), a novel clinical-stage immunocytokine which inhibits the progression of collagen-induced arthritis" ppsx
... levels Mouse plasma cytokine level analysis was performed at Cytolab (Cytolab, Muelligen, Switzerland). A multiplexed parti- cle-based flow cytometric cytokine assay was used [47]. MAP Fluorokine cytokine ... immunoreactivity when tested by affinity chromatography on an EDA-sepharose resin (data not shown) and displayed a biological activity compara- ble with that of recombinant human I...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "The discovery of potential acetylcholinesterase inhibitors: A combination of pharmacophore modeling, virtual screening, and molecular docking studies" pptx
... 268:17083-17095. 18. Barak D, Kronman C, Ordentlich A, Ariel N, Bromberg A, Marcus D, Lazar A, Velan B, Shafferman A: Acetylcholinesterase peripheral anionic site degeneracy conferred by amino acid arrays sharing ... Camps P, Formosa X, Galdeano C, Go mez T, Mun oz-Torrero D, Scarpellini M, Viayna E, Badia A, Clos MV, Camins A: Novel Donepezil-Based Inhibitors of Acetyl- and Butyrylc...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "The boy who refused an IV: a case report of subcutaneous clodronate for bone pain in a child with Ewing Sarcoma" pot
... use and by what route. Cancer-related bone pain is a particularly difficult symptom to treat. Bisphosphonates have gained acceptance as a standard approach to bone pain in adults. In the idealized ... was 23 kg. He had multiple pain complaints including headache, back pain and generalized arthralgia/myalgia. There was a particularly troubling bone pain involving his forearms, wrists...
Ngày tải lên: 11/08/2014, 10:22
Báo cáo y học: "The "incidental" episode of ventricular fibrillation: a case report." pdf
... Vereckei A: Pseudo-ventricular tachycardia: electrocardio- graphic artefact mimicking non-sustained polymorphic ven- tricular tachycardia in a patient evaluated for syncope. Heart 2004, 90:81. 4. Knight ... SA, Morady F: Physi- cian interpretation of electrocardiographic artifact that mimics ventricular tachycardia. Am J Med 2001, 110:335-338. "Ventricular fibrillation" – black d...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: " The Scandinavian Solutions for Wellness study - a two-arm observational study on the effectiveness of lifestyle intervention on subjective well-being and weight among persons with psychiatric disorders" pot
... was defined as a decrease. All analyses were computed using SAS ® 9, SAS Institute Inc., SAS Campus Drive, Cary, North Carolina 27513, USA. Results Participant characteristics In total, 373 participants ... factors diagnosis, duration of illness, psy- chotropic drug at baseline, sex, weight or CGI at baseline had any effect. Waist circumference changes and associated factors In the initial...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ACTCCATACCACTGGTCAGCTG 93.81 ST+7 rs574174 G /A 0.19 0.19 fwd ACGTTGGATGCTGCCCTTGATGATTCCAAG rev ACGTTGGATGGGAACATCACAGGAAATGAC ACTGTCCCCATCCCATC ... ACGTTGGATGTTGCTCAGCCCCAAAGATGG CCCCACAGCCACTGGACAG 93.95 V4 rs2787094 C/G 0.22 0.23 fwd ACGTTGGATGAGAAACAGGAAGGAAGGTCC rev ACGTTGGATGTATGGTTCGACTGAGTCCAC CTGAGTCCACACTCCCCTG 93.8...
Ngày tải lên: 12/08/2014, 16:20
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
... ChangesinDNA,proteoglycan(sulfated glycosaminoglycan) and hyaluronic acid content. Changes in DNA, proteoglycan (sulfated glycosaminoglycan (GAG)) and hyaluronic acid (HA) contents of the annulus fibrosus (AF) and nucleus ... human and many large animal models. On the other hand, larger animals, such as dog and sheep, are very expensive and not appropriate to establish new experimental co...
Ngày tải lên: 12/08/2014, 17:22
Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt
... (the 1 Intensive Care Unit, Osaka University Hospital, Yamadaoka, Suita, Osaka 565, Japan Full list of author information is available at the end of the article Izumi et al. Critical Care 1998, 2:79 http://ccforum.com ... LETTER Letter to the Editor Reiko Izumi RN 1 , Motomu Shimaoka MD, PhD 1,2 , Chiemi Nagaoka RN 1 , Masayasu Komaki RN 1 , Ayako Mizutani RN 1 , Myonsun Yoh PhD 2 , Takesh...
Ngày tải lên: 12/08/2014, 18:20