Báo cáo y học: "Network motif analysis of a multi-mode genetic-interaction network" docx

Báo cáo y học: " Construction and analysis of a modular model of caspase activation in apoptosis" pot

Báo cáo y học: " Construction and analysis of a modular model of caspase activation in apoptosis" pot

... that caspase activa- tion through the intrinsic pathway is delayed relative to that through the extrinsic pathway [62]. Table 5: Summ ary of all rates and parameters for the system Forward rate ... model parameters (forward and reverse reactions, synthesis and degradation rates and parameters for the steady-state abstractions). Addition- ally, a variant of the Jurkat T cell, denoted Jur...

Ngày tải lên: 13/08/2014, 16:21

15 429 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

... BAG3L cagccagataaacagtgtggac BAG3R agaggcagctggagactgg VIRvsLTNP CD8 -1.5 -2.4 ACTA2 NM_001613.1 actin, alpha 2, smooth muscle, aorta ACTA2L ctgttccagccatccttcat ACTA2R tcatgatgctgttgtaggtggt ... proteasome subunit, beta type, 2 PSMB2L agagggcagtggaactcctt PSMB2R gaaggttggcagattcagga VIRvsLTNP CD8 1.3 2.3 PSMA5 NM_002790.2 proteasome subunit, alpha type, 5 PSMA5L tgaatgcaacaaacattgagc PSMA5R...

Ngày tải lên: 13/08/2014, 01:20

21 376 0
Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"

Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"

... echocardiography allowing a three-myocardial layer-specific analysis of deformation pa- rameters. Eur J Echocardiogr 2009; 10(2): 303-308. 9. Becker M, Hoffmann R, Kuhl HP, et al. Analysis of myocardial ... Update for the Clinical Ap- plication of Echocardiography: summary article. A report of the American College of Cardiology/American Heart Association Task Force on Pr...

Ngày tải lên: 25/10/2012, 11:15

8 683 0
Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

Báo cáo y học: "Functional genomics analysis of low concentration of ethanol in human hepatocellular carcinoma (HepG2) cells. Role of genes involved in transcriptional and translational processes"

... forward, 5’-CCTGTACCCGTATTGCGACT-3’; ITGB4 reverse 5’-AGGCCATAGCAGACCTCGTA-3’; COBRA1 for- ward 5’-TGAAGGAGACCCTGACCAAC-3’; COBRA1 reverse 5’-ATCGAATACCGACTGGTGGA-3’; ANK3 forward 5’-GGAGCATCAGTTTGACAGCA-3’; ... 5’-GGAGCATCAGTTTGACAGCA-3’; ANK3 reverse 5’-TTCCACCTTCAGGACCAATC-3’; STAU2 forward 5'-CCGTGAGGGATACAGCAGTT-3'; STAU2 reverse 5’-GCCCATTCAGTTCCACAGTT-3’; HMGN3 forwar...

Ngày tải lên: 31/10/2012, 15:28

8 704 0
Báo cáo y học: "ene expression analysis of human red blood cells"

Báo cáo y học: "ene expression analysis of human red blood cells"

... molecular aspects of malaria patho- genesis during RBC development; (IV) and genomic and proteomic analysis of gene expression in normal adult human erythrocytes. Thus, current array data showed ... total RNA of human RBCs from different donors; B) typical electropherogram of total RNA of human RBCs Microarray analysis of RNA from human RBC s Recent proteomic studie...

Ngày tải lên: 03/11/2012, 10:58

4 399 0
Báo cáo y học: " Quantitative biomarker analysis of synovial gene expression by real-time PCR" potx

Báo cáo y học: " Quantitative biomarker analysis of synovial gene expression by real-time PCR" potx

... target tissue. The use of a cellular standard generated with activated PBMC cDNA significantly improves assay reliability by reducing variation and by simplifying assay development. Analysis of ... quantification have been achieved through the elegant use of computer- based image analysis, and IHC changes can correlate with clinical activity [5,19]. One potential advantage of ima...

Ngày tải lên: 09/08/2014, 01:23

9 557 0
Báo cáo y học: "Cross-sectional analysis of adverse outcomes in 1,029 pregnancies of Afro-Caribbean women in Trinidad with and without systemic lupus erythematosus" ppsx

Báo cáo y học: "Cross-sectional analysis of adverse outcomes in 1,029 pregnancies of Afro-Caribbean women in Trinidad with and without systemic lupus erythematosus" ppsx

... miscarriage has missing gestation; excluded from analyses of early/late miscarriage. j Four miscarriages have missing gestation; excluded from analyses of early/late miscarriage. k Three miscarriages ... however, as patients may not have been referred after a pregnancy was lost. Trinidad was selected as an ideal place for study of pregnancy outcomes as large family sizes are common...

Ngày tải lên: 09/08/2014, 10:22

11 436 0
Báo cáo y học: "Flow cytometry analysis of glucocorticoid receptor expression and binding in steroid-sensitive and steroid-resistant patients with systemic lupus erythematosus" pps

Báo cáo y học: "Flow cytometry analysis of glucocorticoid receptor expression and binding in steroid-sensitive and steroid-resistant patients with systemic lupus erythematosus" pps

... may be involved in tissue sensitivity to GCs [10]. Other studies have shown no Figure 1 Evaluation of FCM analysis of GR binding by RLBAEvaluation of FCM analysis of GR binding by RLBA. Analysis ... Derivation of the SLEDAI: a disease activity index for lupus patients. Arthritis Rheum 1992, 35:630-640. 26. Seki M, Ushiyama C, Seta N, Abe K, Fukazawa T, Asakawa J, Taka- saki...

Ngày tải lên: 09/08/2014, 14:22

11 414 0
Báo cáo y học: "Community-wide analysis of microbial genome sequence signatures" pptx

Báo cáo y học: "Community-wide analysis of microbial genome sequence signatures" pptx

... mem-bers of the Thermoplasmatales with the same %GC (E-plasma, G-plasma, Ferroplasma types I and II) are indicated with stars: TATA, ATAT, GATC. (A) All Iron Mountain AMD bacterial and archaeal genomes, ... obtained (C-plasma, D-plasma, and a diver- gent type of A- plasma); several Actinobacteria; and multiple more shallowly sampled populations, including a gammapro- teobacterium and...

Ngày tải lên: 09/08/2014, 20:20

16 376 0
Báo cáo y học: "Genome-wide analysis of the diatom cell cycle unveils a novel type of cyclins involved in environmental signaling" pptx

Báo cáo y học: "Genome-wide analysis of the diatom cell cycle unveils a novel type of cyclins involved in environmental signaling" pptx

... (21159) Homsa;CYCG1 Homsa;CYCG2 Arath;CYCD4;1 Arath;CYCD2;1 Homsa;CYCJ Homsa;CYCE2 Arath;CYCB1;1 Arath;CYCB3;1 Thaps (36441) Phatr;CYCP6 Phatr;CYCP4 Phatr;CYCP1 Phatr;CYCP5 Phatr;CYCP3 Phatr;CYCP2 Phatr;CYCH1 Phatr;CYCL1 Phatr;CYCD1 Phatr;CYCA/B;1 Arath;SDS Phatr;CYC-like Thap ... (264631) Thaps (20925) Arath;CYCH1 Ostta;CYCH Thaps (3949) Homsa;CYCL1 Arath;CYCL1;1 Thaps (17396) Thaps (17337)...

Ngày tải lên: 09/08/2014, 20:21

19 452 0
Từ khóa:
w