Báo cáo y học: " A small RNA makes a Bic difference" pptx
Báo cáo y học: " A small RNA makes a Bic difference" pptx
... ofidentified miRNAs and knockout mice increases, it becomesincreasingly probable that knockout mice may inadvertentlyaffect miRNA gene expression. In these cases, phenotypesmust be carefully analyzed ... The general notionin the miRNA field is that the effect of any one miRNA onany one gene may be small in degree. Indeed, it is likely thatmiRNAs gain their power from cooperative activity in genesilencing. ... have inadvertently altered intronic miRNA gene expres-sion. To investigate this possibility, we searched knownmouse knockout databases against known databases ofannotated miRNA genes. Examples...
- 4
- 149
- 3
Báo cáo y học: " Dual paraneoplastic syndromes in a patient with small cell lung cancer: a case report" pdf
... ReninAmenorrhea, galactorrhea <1% Prolactin, GHHyperamylasemia <1% Salivary anylaseLambert-Eaton myasthenicsyndrome1% Anti-VGCC Synaptotagmin, MysBEncephalomyelitis <1% Anti-Hu ... The patient complained only of intermittent diarrhea. Her laboratory values exhibitedmetabolic alkalosis with hypokalemia, hypocalcemia, hypomagnesemia, hypophosphatemia, and hyperglycemia.Conclusion: ... cited.that our patient did not display all of the electrolyteabnormalities generally seen in patients with this syn-drome (hypokalemia, achlorhydria, metabolic acidosis,and hypercalcemia) because...
- 4
- 263
- 0
Báo cáo y học: "Four small supernumerary marker chromosomes derived from chromosomes 6, 8, 11 and 12 in a patient with minimal clinical abnormalities: a case report" pdf
... was also a boy who died after two days due tohyaline membrane disease and prematurity. Our patientwas delivered by caesarean section after 39 gestationalweeks because of macrosomy, with a weight ... Case presentationOur patient was a 30-year-old Spanish Caucasian man;the third child from healthy and non-consanguineousparents. The first child was a healthy boy a nd the sec-ond child was ... parents had normal karyo-types. Now, at the age of 30 years a new blood samplefor cytogenetic analysis was requested. Surprisingly, thehigh resolution G-band karyotype attained from thissample...
- 4
- 229
- 0
Báo cáo y học: "Acute small bowel obstruction as a result of a Meckel''''s diverticulum encircling the terminal ileum: A case report" pdf
... abdominal orgenitourinary symptoms. The patient had an unremarka-ble past surgical history, with no prior abdominal surgery,and a past medical history of only hypercholesterolaemia.On examination, ... Meckel's diverticulum,only 2% are symptomatic and they tend to be typicallybelow the age of two, thereby accounting for why this con-genital gastrointestinal anomaly is comparatively betterstudied ... previouslyreported.Case Report A fit and healthy 74-year-old gentleman presented to theaccident and emergency department at the West SuffolkHospital with a 3-day history of abdominal pain, vomit-ing,...
- 5
- 311
- 0
Báo cáo y học: "Non-small cell lung cancer presenting with choroidal metastasis as first sign and showing good response to chemotherapy alone: a case report" pot
... borders.Overlying retinal detachment is common and soundattenuation in the lesion is usually moderate [7]. Treat-ment options available are e xternal beam radiotherapy,plaque radiotherapy, and new methods ... probably because of the relatively greater bloodflow to that area [1]. Among women, the primary s itesfor choroidal metastasis are the breast, lung, unknownprimary, gastrointestinal and pancreas, ... most primary tumors is 30 grays in daily frac-tions of 300 centigrays. Occasionally, patients withprolonged survival are more likely to require a totaldose of 45 to 50 Grays in daily fractions...
- 4
- 500
- 0
Báo cáo y học: " Paraneoplastic limbic encephalitis as a cause of new onset of seizures in a patient with non-small cell lung carcinoma: a case report" potx
... Hypothalamic dysfunction may occur,with somnolence, hyperthermia and endocrine abnor-malities. PLE may present as an isolated neurological syn-drome or as a part of PEM. It may occasionally ... neurological syn-dromes are Lambert-Eaton myasthenic syndrome andparaneoplastic encephalomyelitis (PEM). Paraneoplasticneurological syndromes are caused by autoimmune proc-esses triggered by cancers ... antibodies are alsocalled anti-Ta antibodies. Other autoantibodies occasion-ally observed in SCLC patients are anti-amphiphysin andanti-CV2 antibodies. All of the aforementioned antibod-ies are 'well...
- 5
- 259
- 0
Báo cáo y học: "Atypical clinical presentation of a subset of patients with anti-RNA polymerase III - nonscleroderma cases associated with dominant RNA polymerase I reactivity and nucleolar staining" potx
... Kuwana M, Okano Y, Pandey JP, Silver RM, Fertig N, Medsger TA Jr:Enzyme-linked immunosorbent assay for detection of anti -RNA polymerase III antibody: analytical accuracy and clinical associations ... hat all three cases of non-SSc anti-RNAP III positive patients had predominant RNAP Ireactivity with weak RNAP III reactivity and had a strong nucleolar staining that is not always seen in anti-RNAP ... III antibody levels in systemic sclerosis.Rheumatology (Oxford) 2009, 48:1218-1221.20. Cavazzana I, Angela C, Paolo A, Stefania Z, Angela T, Franco F: Anti -RNA polymerase III antibodies: a marker...
- 7
- 319
- 0
Báo cáo y học: "Exploring systemic RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium" potx
... The RNAi pathway and miRNA path-way are essentially parallel, using related but distinct proteinsat each step. For instance, in Drosophila, Dicer2, R2D2 andArgonaute2 are involved in the RNAi ... to act in theRNAi pathway [9,80], while Alg-1 and Alg-2 are important forthe miRNA pathway [81]. Yigit et al. [80] identified yetanother class of Argonaute proteins, the secondary Argonau-tes ... T7sequence at their 5' end were used to create a EGFP dsRNAtemplate (520 bp) [GFPiF2:taatacgactcactatagggcgatgccacct,GFPiR5: taatacgactcactatagggcggactgggtg] (the T7 site isunderlined). dsRNA...
- 22
- 223
- 0
Báo cáo y học: "Emergency intraosseous access in a helicopter emergency medical service: a retrospective study"
... emergency medicalteam. J Trauma 2009, 66:1739-1741.15. Zakariassen E, Burman RA, Hunskaar S: The epidemiology of medicalemergency contacts outside hospitals in Norway a prospectivepopulation based ... Endotracheal, umbilical or intracar-dial routes are poorer alternatives as regards speed ofinsertion and reliability in emergency resuscitation.Great saphenous vein cutdown as an emergency surgicalapproach ... PubMed, CAS, Scopus and Google Scholar• Research which is freely available for redistributionSubmit your manuscript at www.biomedcentral.com/submitSunde et al. Scandinavian Journal of Trauma, Resuscitation...
- 5
- 559
- 0
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"
... recovery was une-ventful, and the patient was discharged on postoper-ative day 4. Fig.1 Fluid collection and left ovary cyst was noted on computed tomography. The size of ovary cyst was 2.0 ... of a monolayer of inner circular muscle, which makes its wall weak, as com-pared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers. The vasa ... invagination of diverticu-lum has an advantage over diverticulectomy in that it minimizes bowel leakage [15]. Moreover, invagina-tion of diverticulum can be easily performed using laparoscopy...
- 3
- 531
- 0
Từ khóa: báo cáo khoa học y họcbáo cáo y họcbáo cáo y học cổ truyềnbáo cáo y tế học đườngmẫu báo cáo y tế học đườngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ