Báo cáo y học: " Identification of structural aberrations in cancer by SNP array analysis Stefan Heinrichs and A Thomas Loo" pot
Báo cáo y học: " Identification of structural aberrations in cancer by SNP array analysis Stefan Heinrichs and A Thomas Loo" pot
... Biology 2007, 8:219 Minireview Identification of structural aberrations in cancer by SNP array analysis Stefan Heinrichs and A Thomas Look Address: Dana-Farber Cancer Institute, Department of Pediatric ... genomic aberrations of a cell line panel by SNP array copy-number analysis. Clustering of the cell lines according to their copy-number abe...
Ngày tải lên: 14/08/2014, 07:22
Báo cáo y học: "Identification of cyanobacterial non-coding RNAs by comparative genome analysis" potx
... page) TIS yfr2-5 y_ gen y2 a- 5aM TATA Yfr2 MED : CATATTAAAAAGGTGTGTAGGAGAGGTTTTACTGAAACAGTGGAAACAAGGAAA Yfr5 MED : GAAATTTAAATTGTGTGTAGGAGAGGTTTTATTAAATCAGTGGAAACAAGGAAA Yfr3 MED : TATGTTATATATGTGTGTAGGAGAAGTTTTACTGAAACAGTGGAAACAAGGAAA ... TATGTTATATATGTGTGTAGGAGAAGTTTTACTGAAACAGTGGAAACAAGGAAA Yfr4 MED : TAGTTTATTGTTGTGTGTAGGAGAGTTTTTACTGAAACAGTGGAAACAAGGAAA * 20 * 40 * Yfr2 M...
Ngày tải lên: 14/08/2014, 14:22
Báo cáo y học: " Identification of arthritis-related gene clusters by microarray analysis of two independent mouse models for rheumatoid arthritis" pdf
... HTLV-I and HTLV- II Volume 2. New York: Plenum Press; 1993. 7. Iwakura Y, Saijo S, Kioka Y, Nakayama-Yamada J, Itagaki K, Tosu M, Asano M, Kanai Y, Kakimoto K: Autoimmunity induction by human T ... Tosu M, Yoshida E, Takiguchi M, Sato K, Kitajima I, Nishioka K, Yamamoto K, Takeda T, Hatanaka M, et al.: Induction of inflammatory arthropathy resembling rheumatoid arthritis in mice t...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: " Identification of fusion genes in breast cancer by paired-end RNA-sequencing" potx
... Fujiwara S, Watanabe H, Kurashina K, Hatanaka H, Bando M, Ohno S, Ishikawa Y, Aburatani H, Niki T, Sohara Y, Sugiyama Y, Mano H: Identification of the transforming EML4-ALK fusion gene in non-small-cell ... Nature 2010, 465:473-477. 19. Palanisamy N, Ateeq B, Kalyana-Sundaram S, Pflueger D, Ramnarayanan K, Shankar S, Han B, Cao Q, Cao X, Suleman K, Kumar-Sinha C, Dhanasekaran SM, Ch...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo y học: "Identification of 491 proteins in the tear fluid proteome reveals a large number of proteases and protease inhibitors" pot
... C4 † C 4A 2,5 Cystatin B CSTB Cystatin SN* CST1 Cystatin SA* CST2 Cystatin C* CST3 Cystatin S* CST4 Inter-alpha-trypsin inhibitor heavy chain H1* ITIH1 5 Inter-alpha-trypsin inhibitor heavy chain ... 5 Inter-alpha-trypsin inhibitor heavy chain H4 † ITIH4 5 Lipocalin 1* LCN1 5 Similar to Lipocalin 1 Lipocalin 2 LCN2 Latexin † LXN Prosaposin † PSAP Alpha-1-antitrypsin* SERPINA1 5 Alpha-1-antic...
Ngày tải lên: 14/08/2014, 17:22
Báo cáo y học: " Identification of CDK2 substrates in human cell lysates" ppt
... GST-Rb kinase assay using 5 μg of GST-Rb and 0.5 μg of cyclin A- CDK2 (F8 0A) complex. Mass spectrometry analysis and database search Phosphopeptides samples were analyzed by microcapillary high ... direct cyclin A- CDK2 substrates in human cell lysates. CDK2 is activated by both the cyclin E and cyclin A subunits, and cyclin A- CDK2 plays critical roles in cell cyc...
Ngày tải lên: 14/08/2014, 21:20
báo cáo hóa học: " Identification of symptom domains in ulcerative colitis that occur frequently during flares and are responsive to changes in disease activity" ppt
... ques- tionnaire. Data management and statistical analysis Two study team members (J.C.J. and T.K.) determined each symptom domain's rating for each of the three end- points by independently measuring ... with increased fecal calprotectin levels, a biomarker of inflam- matory activity. This suggests that symptoms typically attributed to IBS may actually indicate smoldering s...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo y học: "Efficacy of TachoSil® patches in controlling Dacron suture-hole bleeding after abdominal aortic aneurysm open repair" potx
... from Dacron grafts in aortic surgery. Materials and methods Between June 2007 and June 2008 a total of 20 patients with intact infrarenal abdominal aortic aneurysm (AAA) were randomized in the same ... after elective infrarenal abdominal aortic aneurysm (AAA) replacement with Dacron graft. Materials and methods: Patients undergoing elective replacement of infrarenal AAA with D...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: ": Suppression of neutrophil accumulation in mice by cutaneous application of geranium essential oi" doc
... of intraperitoneal injection of curdlan against neutrophil accumulation and MPO activity. Curdlan or saline was injected intraperitoneally, and immediately and 3 hr after the injection, geranium ... were expressed by the mean ± standard devia- tion. All statistical analysis was calculated using the StatView software. Statistical analysis was performed as Journal of Inflamma...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " Survivors of the war in the Northern Kosovo: violence exposure, risk factors and public health effects of an ethnic conflic" pdf
... nurse and two Serbian-speaking psychology students of Albanian ethnicity. The team members received a four-day training in survey and safety procedures. Each municipality office was informed in advance ... for discrepancies. Statistical analysis Data entry, processing, and analysis were carried out using Microsoft Access 2000, Epi Info™ 6.04 (CDC Atlanta, USA, 2001), and S...
Ngày tải lên: 13/08/2014, 14:20