Báo cáo y học: "Celsius: a community resource for Affymetrix microarray data" pot

... cited.Celsius: a warehouse for microarray data<p>Celsius is a new system that serves as a warehouse by aggregating Affymetrix files and associated metadata, and containing the largest publicly available ... Bioinformatics2005, 21:1495-1501.3. Rhodes D, Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D,Barrette T, Pandey A, Chinnaiyan A: Large-scale meta-analysis ofcancer microarray data identifies ... data is compromisedby the low quality of clinically or experimentally relevantannotated metadata actually available for many datasets, aswell as the inconsistent and incomplete implementation...

Báo cáo y học: " NeMeSys: a biological resource for narrowing the gap between sequence and function in the human pathogen Neisseria meningitid" pot

... biochemical pathway (for sulfur metabolism) that may potentially be important for nasopharyngeal colonization.Conclusions: By improving our capacity to understand gene function in an important humanpathogen, ... chromosomal inversions (Additional data file 1).To achieve an annotation as accurate as possible, we anno-tated 8013's genome manually by taking advantage of all thefunctionalities of ... graphicalinterface (MaGe) for data visualization and exploration; andthe large Prokaryotic Genome DataBase (PkDGB) for datastorage, which contains more than 400 microbial genomes.We devoted particular care...

Báo cáo y học: "NetPath: a public resource of curated signal transduction pathway" ppsx

... Keerthikumar S, Mathivanan S, Patankar N, Shafreen B,Renuse S, Pawar H, Ramachandra YL, Prasad TSK, Acharya PK,Ranganathan P, Chaerkady R, Pandey A: Human Proteinpedia: A unifieddiscovery resource for ... Hariprasad Padhukasahasram1,Yashwanth Subbannayya1, Renu Goel1, Harrys KC Jacob1,2, Jun Zhong2, Raja Sekhar1, Vishalakshi Nanjappa1,Lavanya Balakrishnan1, Roopashree Subbaiah1, ... in data models, data accessmethods and file formats. This leads to the incompat-ibility of data formats for the analysis of pathway data.To avoid this, data standards are adopted by many ofthe...

Báo cáo y học: "TWEAK: a novel biomarker for lupus nephritis" pot

... inadequate becausesubstantial renal tissue damage can occur before function isimpaired to a detectable extent [4]. Renal biopsy remains thegold standard for assessment of LN disease activity. ... injury has anti-inflammatory effects [5].In the current paper by Schwartz and colleagues, TWEAKwas assessed as a biomarker for LN in both cross-sectionaland longitudinal studies. In the former, ... sensitivity and specificity. In the previous issue of ArthritisResearch & Therapy, Schwartz and colleagues demonstrated thepotential value of urinary TNF-like weak inducer of apoptosis(uTWEAK) as...

Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx

... S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, Suzuki H, Carninci P, Hayashizaki Y, Wells C, Frith M, Ravasi T, Pang KC, Hallinan J, Mattick ... computational analysis. WS and DH analyzed thedata. WS, DH and ML wrote the manuscript. All authors read and approved thefinal manuscript.AcknowledgementsWe thank Benjamin Haley for sharing ... apparent false negative rate of approxi-mately 5% and a false discovery rate of approximately19%.To systematically compare the miRTRAP and miRDeepmethods, we tested the new Ciona library data using...

Báo cáo y học: "Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences" ppsx

... of 13are examples of metadata) - to repeat an analysisexactly. When a user performs an analysis using Galaxy,it automatically generates metadata for each analysisstep. Galaxy’s metadata includes ... computational biologyexperiment. Galaxy provides a framework for perform-ing computational analyses, systematically repeating ana-lyses, capturing all details of performed analyses, andannotating ... reproducible research system.AcknowledgementsGalaxy is developed by the Galaxy Team: Enis Afgan, Guruprasad Ananda,Dannon Baker, Dan Blankenberg, Ramkrishna Chakrabarty, Nate Coraor,Jeremy Goecks,...

Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf

... transcription factor genes in prostate cancer. Science 2005,310:644-648.24. Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, Fujiwara S,Watanabe H, Kurashina K, Hatanaka H, Bando ... resulting as fusion candidates are discardedbecause their homology can potentially cause a misa-lignment. We use TreeFam to identify and remove thesecandidates [36,37]. TreeFam is a database of phylo ... using Platinum Taq DNA Polymer-ase (Invitrogen) with 1 mM MgCl2,0.1μM of each pri-mer (forward, TMPRSS2 exon 1 - TAGGCGCGAGCTAAGCAGGAG; reverse, ERG exon 5 -GTAGGCACACTCAAACAACGACTGG; as publishedby...

báo cáo khoa học: " VitisExpDB: A database resource for grape functional genomics" pps

... Consortia Program, Affymetrix introduced the 16K array GeneChip® Vitis vinif-era (Grape) Genome Array ver. 1.0 (Affymetrix ® Inc., SantaClara, CA), fabricated mainly for V. vinifera microarray studies. ... the database. HLand AW helped with the development of similarity searchparameters and HL and EC helped with microarray dataExample result pages of a Microarray database queryFigure 4Example ... for usersto compare data between Affymetrix gene chip array andother custom arrays is also planned as a part of futuredatabase expansion. The VitisExpDB database will beupdated frequently...

Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx

... -GCCTCCACTGTGCTCACTGA-3’;forwardprimerforhumanb-actin, 5’-TGGCACCCAGCACAATGAA-3’;andreverseprimer for human b-actin, 5’-CTAAGTCATAGTCCGCC-TAGAAGCA-3’. Primer efficiency was determined by seri-ally diluting a standard ... Supplementary materials and methods. This tablesummarizes the clinical data of patients with RA, OA and AS.Additional file 2: Supplementary results. This table provides the raw microarray data to ... bloodsamples from RA, OA and AS patients and the healthy controls. AS,ankylosing spondylitis; OA, osteoarthritis; RA, rheumatoid arthritis.Chang et al. Arthritis Research & Therapy 2011,...

Báo cáo y học: " Pruritus: a useful sign for predicting the haemodynamic changes that occur following administration of vancomycin" ppsx

... physician to identifyat an early stage those patients who are at risk for hypoten-sion (e.g. hypovolaemic patient) and to compensate for hypo-volaemia before continuing administration of vancomycin.This ... the radial artery cannulaand another from the distal port of the pulmonary arterycatheter) in order to measure arterial and mixed venous bloodparameters that are necessary for calculation ... devices had been positioned (electrocar-diograph leads DII–V5 for ST-segment analysis; radial arterycannula and pulmonary artery catheter [Arrow AH 050050-H,7.5 F; Arrow International, Inc., Reading,...

Xem thêm

Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018 Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ