Báo cáo y học: " Analysis of 14 BAC sequences from the Aedes aegypti genome: a benchmark for genome annotation and assembly" docx

Báo cáo y học: " Analysis of 14 BAC sequences from the Aedes aegypti genome: a benchmark for genome annotation and assembly" docx

Báo cáo y học: " Analysis of 14 BAC sequences from the Aedes aegypti genome: a benchmark for genome annotation and assembly" docx

... data that may clarify the origin of duplicated tran- scripts in the genome assembly. BAC assembly The quality of these BAC assemblies is critical for a valid assessment of the genome assembly ... and sequencing. This benchmark analysis of the Aedes genome has yielded a set of manually annotated transcripts that has been validated with molecular and...
Ngày tải lên : 14/08/2014, 07:21
  • 12
  • 320
  • 0
Báo cáo y học: "Analysis of Fcγ receptor haplotypes in rheumatoid arthritis: FCGR3A remains a major susceptibility gene at this locus, with an additional contribution from FCGR3B" ppsx

Báo cáo y học: "Analysis of Fcγ receptor haplotypes in rheumatoid arthritis: FCGR3A remains a major susceptibility gene at this locus, with an additional contribution from FCGR3B" ppsx

... laboratory work, analyzed the data and prepared the manuscript. JHB gave additional statistical support and performed the haplo- type analysis. BG, RDS and PE participated in the collection of ... susceptibility One advantage of the HTR framework for analysis of haplo- types is that other factors can be included in the model. The analysis was repeated includin...
Ngày tải lên : 09/08/2014, 07:20
  • 9
  • 450
  • 0
Báo cáo y học: "Analysis of infectious virus clones from two HIV-1 superinfection cases suggests that the primary strains have lower fitnesc" ppt

Báo cáo y học: "Analysis of infectious virus clones from two HIV-1 superinfection cases suggests that the primary strains have lower fitnesc" ppt

... supernatant and cells were harvested at day 7 after infection and stored at -80°C for further analysis. HTA analysis of dual infections The viral DNA of all dual-infected and mono-infected cultures was ... 5′-TCTTGCCTGGAGCT GTTTGATGCCCCAGAC-3′ and EnvB: 5′ -AGAAA- GAGC AGAAGACAGTGGCAATGA-3′), followed by nested primers (E125 5′ -CAATTTCTGGGTCCCC TCCTGAGG-3′ and E80 5′ -C...
Ngày tải lên : 13/08/2014, 01:20
  • 15
  • 319
  • 0
Báo cáo y học: "Analysis of XMRV integration sites from human prostate cancer tissues suggests PCR contamination rather than genuine human infection" ppt

Báo cáo y học: "Analysis of XMRV integration sites from human prostate cancer tissues suggests PCR contamination rather than genuine human infection" ppt

... tgagccagatcatgcctctgcactccagcctgggcaacagagcaagactc ************************************************** EU981808 catctcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa GU816103 catctcaaaaaaaaaaaaaaaaaaaaaaaaaa ... CTCCTCAGAGTGATTGACTACCCAGCTCGGGGGTCTTTCAaaagcacaca GU816103 ATTGACTACCCAGCTCGGGGGTCTTTCAaaagcacaca ************************************** EU981808 gatataagtgctgtcatatagtaaatgcctaaataaaagtgttttgtgta...
Ngày tải lên : 13/08/2014, 01:20
  • 3
  • 209
  • 0
Báo cáo y học: "Comparison of dot chromosome sequences from D. melanogaster and D. virilis reveals an enrichment of DNA transposon sequences in heterochromatic domains" docx

Báo cáo y học: "Comparison of dot chromosome sequences from D. melanogaster and D. virilis reveals an enrichment of DNA transposon sequences in heterochromatic domains" docx

... in the use of consed. Michael Brent and Mani Arumugam aided in annotation and analysis of fosmid sequences. We would like to thank Alan Templeton for his help in the sta- tistical analysis of ... Berkeley National Lab, Berkeley, CA, USA) for access to and use of their D. virilis whole genome PILER-DF library and HP Yang (National Yang-Ming Univer- sity, Taipei...
Ngày tải lên : 14/08/2014, 16:21
  • 18
  • 267
  • 0
Báo cáo y học: "Treatment of psychotic symptoms in bipolar disorder with aripiprazole monotherapy: a meta-analysis" pps

Báo cáo y học: "Treatment of psychotic symptoms in bipolar disorder with aripiprazole monotherapy: a meta-analysis" pps

... Sanofi, Eli Lilly Organon, Servier and Richter Acknowledgements KNF had full access to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of ... problem of quality for RCTs today and limit the generalisability of results [49]. A limitation of this review is that most of the trials were sponsored by th...
Ngày tải lên : 08/08/2014, 23:21
  • 10
  • 548
  • 0
Báo cáo y học: "Analysis of HLA DR, HLA DQ, C4A, FcγRIIa, FcγRIIIa, MBL, and IL-1Ra allelic variants in Caucasian systemic lupus erythematosus patients suggests an effect of the combined FcγRIIa R/R and IL-1Ra 2/2 genotypes on disease susceptibility" pptx

Báo cáo y học: "Analysis of HLA DR, HLA DQ, C4A, FcγRIIa, FcγRIIIa, MBL, and IL-1Ra allelic variants in Caucasian systemic lupus erythematosus patients suggests an effect of the combined FcγRIIa R/R and IL-1Ra 2/2 genotypes on disease susceptibility" pptx

... contributions AJ was responsible for data analysis and interpretation and wrote the report. AAB contributed to the data analysis and interpretation. GS and LT were both responsible for the planning of the work ... SLE diagnosis, the index case, was included in the statistical analysis. The mean age at diagnosis of the patients was 40 years (range 10–83) a...
Ngày tải lên : 09/08/2014, 01:24
  • 6
  • 292
  • 0
Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx

Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx

... daily at the time of analysis. After developing parotid gland enlargement, lymphoma of the parotid gland was excluded by partial parotidectomy and histo- logical examination. After approval by ... >1). The duration of the disease was 9 years at the time of analysis. The patient expressed elevated titers of anti-52 kDa Ro(SS -A) and anti-52 kDa La(SS-B) antibodie...
Ngày tải lên : 09/08/2014, 03:24
  • 12
  • 441
  • 0
Báo cáo y học: "Analysis of normal and osteoarthritic canine cartilage mRNA expression by quantitative polymerase chain reacti" potx

Báo cáo y học: "Analysis of normal and osteoarthritic canine cartilage mRNA expression by quantitative polymerase chain reacti" potx

... Probe ADAMTS5 TGGGTTCCCAAATATGCAG CTGTCCCATCCGTCACCT CTGGGAGA 1AGC1 GGGACCTGTGTGAGATCGAC GTAACAGTGGCCCTGGAACT AGGAGCTG BGN CAGAACAACGACATCTCAGAGC TCACCAGGACGAGAGCGTA CTCCACCA COL 1A2 CTATCAATGGTGGTACCCAGTTT ... ACTCTGGGATCACGCATGT CTGCCTTC LUM ACCTGGAAATTCTTTTAATGTATCATC CGGTATGTTTTTAAGCTTATTGTAGGA TGCTGGAG MMP13 CCGCGACCTTATCTTCATCT AACCTTCCAGAATGTCATAACCA AGAGGCAG RPL1 3A CTGCCCCACAAGACCAA...
Ngày tải lên : 09/08/2014, 08:22
  • 9
  • 386
  • 0
Báo cáo y học: "Analysis of bronchoalveolar lavage fluid proteome from systemic sclerosis patients with or without functional, clinical and radiological signs of lung fibrosis" pot

Báo cáo y học: "Analysis of bronchoalveolar lavage fluid proteome from systemic sclerosis patients with or without functional, clinical and radiological signs of lung fibrosis" pot

... collected aliquot was used for the microscopic and cultural examination of common bacteria and fungi, and of direct acid-fast bacilli smears (Kinyoun method) and cultures for mycobacteria, and for the ... Cardiovascular Sciences, University of Pavia, Via Taramelli 5, 27100 Pavia, Italy 2 Department of Biochemistry, University of Pavia, Via Taramelli 5, 27100 Pavi...
Ngày tải lên : 09/08/2014, 08:22
  • 11
  • 478
  • 0

Xem thêm