Báo cáo y học: " Endothelial Bacteremia is an independent ri

Báo cáo y học: " Endothelial Bacteremia is an independent risk factor for mortality in nosocomial pneumonia: a prospective and observational multicenter study" potx

... Access Bacteremia is an independent risk factor for mortality in nosocomial pneumonia: a prospective and observational multicenter study Mònica Magret 1 , Thiago Lisboa 2 , Ignacio Martin-Loeches 3 , Rafael ... Tarragona, Spain), Wolfgang Krueger (Tuebingen University Hospital, Tuebingen and Constance Hospital, Constance, Germany), Thiago Lisboa (Joan XIII Un...

Ngày tải lên : 14/08/2014, 07:21

8
311
0

Báo cáo y học: "Rheumatoid arthritis is an independent risk factor for multi-vessel coronary artery disease: a case control study" pdf

... contributes to accelerated CAD. The inflammatory mechanisms in RA may enhance atherogen- esis in several ways. C-reactive protein, a useful marker of disease activity, is elevated in RA and has prognostic ... evaluation. Coronary angiogram data Angiographic data was retrieved from the Mayo Clinic coronary care unit database. Mayo Clinic cardiologists who performed the study...

Ngày tải lên : 09/08/2014, 06:23

8
401
0

Báo cáo y học: "Renal replacement therapy is an independent risk factor for mortality in critically ill patients with acute kidney injury" potx

... C, Macedo E, Gibney N, Tolwani A, Oudemans-Van Straaten HM, Ronco C: Patient and kidney survival by dialysis modality in critically ill patients with acute kidney injury. Int J Artif Organs 2007, ... (RRT), mortality remains remarkably high in these patients. A review by YP Ympa and colleagues, including 80 stu- dies covering 15,897 patients, revealed that mortality rates remai...

Ngày tải lên : 14/08/2014, 07:21

9
221
0

Báo cáo y học: "Intensive care acquired infection is an independent risk factor for hospital mortality: a prospective cohort study" pot

... of infection, and a favorable response to antimicrobial therapy. Data registration and statistical analysis Data were collected daily by one of the authors (PY) and entered into an SPSS database ... study and the analysis of data and drafted the manuscript. PO participated in the design of the study and performed the statistical analysis. All authors read and approved the...

Ngày tải lên : 12/08/2014, 23:23

6
259
0

Báo cáo y học: "Circulating RANKL is inversely related to RANKL mRNA levels in bone in osteoarthritic males" potx

... GAPDH, forward: ACCCAGAAGACTGTGGATGG; GAPDH, reverse: CAGTGAGCTTCCCGTTCAG; OPG, forward: CTGTTTTCACAGAGGTCAATATCTT; OPG, reverse: GCTCACAAGAACAGACTTTCCAG; and RANKL, forward: CCAAGATCTCCAACATGACT; ... variables and female and male age-related changes. Statistical analysis was performed using GraphPad Prism software (V4.00 for Windows; Graph- Pad Software, San Diego, CA, USA). The...

Ngày tải lên : 09/08/2014, 10:22

9
410
0

Báo cáo y học: "Endoscopic therapy using an endoscopic variceal ligation for minute cancer of the esophagogastric junction complicated with esophageal varices: a case report" ppt

... competing interests. Authors' contributions TA, YA, HT and KY analyzed and interpreted our patient data. HI, HE and KH analyzed endoscopic data. AR, SY and YI performed the histological examination of ... Kyoko Yoneda 1 , Hirokazu Takahashi 1 , Masahiko Inamori* 1 , Akihide Ryo 2 , Shoji Yamanaka 2 , Yoshiaki Inayama 2 and Atsushi Nakajima 1 Abstract Introduction: Standard...

Ngày tải lên : 11/08/2014, 12:20

3
284
0

Báo cáo y học: " Incisional hernia as an unusual cause of hepatic encephalopathy in a 62-year-old man with cirrhosis: a case repor" ppsx

... emergency department. Thereafter, intravenous potassium supple- ments in saline and in dextrose solution were given and an enema containing lactulose and ampicillin was given twice a day for 10 days. ... cirrhosis. The decision for herniorrhaphy in such patients should be made after evaluating the possible benefits and risks of the surgery. Abbreviations ALT, alanine ami...

Ngày tải lên : 11/08/2014, 17:21

4
346
0

Báo cáo y học: " Interleukin-17 regulation: an attractive therapeutic approach for asthma" potx

... BAL fluids and AHR [71]. Inspiringly, the clinical trials evaluating the efficacy, safety, and tolerability of a monoclonal Ab against IL-17 in treatment-resistant patients with various inflammatory ... implications for signal transduction and therapy. Cytokine 2008, 41:92-104. 47. Rahman MS, Yamasaki A, Yang J, Shan L, Halayko AJ, Gounni AS: IL-1 7A induces eotaxin-1/CC chem...

Ngày tải lên : 12/08/2014, 11:22

11
194
0

Báo cáo y học: "Endothelial Cytomegalovirus infection monitored by quantitative real-time PCR in critically ill patients" pps

... Table 1. Patient characteristics Patient Age (years) TBSA (%) DBSA (%) IGS 2 score ICU stay (days) Viremia peak a Outcome 1 80 15 0 41 30 9,130 Discharged from ICU 2 76 40 ... Died in ICU 3 82 15 15 54 133 130,000 Discharged from ICU 4 60 28 20 29 105 137,000 Died in ICU a Viremia peak is expressed in copies/ml. DBSA, deep burn surface area; TBSA, total burn surface area. Figure ....

Ngày tải lên : 14/08/2014, 07:21

2
480
0

Báo cáo y học: "The clinical utility of molecular diagnostic testing for primary immune deficiency disorders: a case based review" doc

... Details 1 Department of Clinical Immunology Auckland City Hospital, Park Rd, Grafton, Auckland New Zealand, 2 LabPlus, Auckland City Hospital, Park Rd, Grafton, Auckland New Zealand and 3 Central and Southern ... Zealand laboratory accrediting agency * Correspondence: immunology@xtra.co.nz 1 Department of Clinical Immunology Auckland City Hospital, Park Rd, Grafton, Auckland New Zea...

Ngày tải lên : 08/08/2014, 21:20

9
480
0