Báo cáo y học: "Usefulness of N-terminal pro-brain natriuretic peptide and C-reactive protein to predict ICU mortality in unselected medical ICU patients: a prospective, observational study" pot

... SOX catalyses the o xidative demethylati on of sarcosine (N-methylglycine) to form glycine and formalde- hyde. Similarly, DAAO catalyses the oxidative d eamination of neutral and (with a lower ... oxidize D -proline, D -alanine and D -2-aminobutyrate with similar relative efficiencies. Analogously, GO and MSOX show a fairly similar activity o n s arcosine and N-ethylglycine...

Ngày tải lên: 08/03/2014, 16:20

... reasonable patient or their family to object to publication of this case report and any accompanying images. Competing interests The authors declare that they have no competing interests. Authors' ... this article as: Levy et al., Lack of correlation between pulmonary dis- ease and cystic fibrosis transmembrane conductance regulator dysfunction in cystic fibrosis: a case...

Ngày tải lên: 11/08/2014, 12:20

... the in vivo and cellular assays and analysis and interpretation of data, EJM, MW and CL participated in the design of the study and analysis and interpretation of data. HB conceived of the study, participated ... sense ATAGGATCCTGCTAAGACTCCCCACCGTAA 2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT 3 Negative sense RNA-specific cDNA...

Ngày tải lên: 12/08/2014, 01:22

... we introduce a new computational strategy to predict the targets of CDKs and use it to identify new biologically interesting candidates. Our data suggest that regulatory modules may exist in protein ... each of those proteins. Additional data files The following additional data are available with the online version of this paper. Additional data file 1 contains the S. cer-...

Ngày tải lên: 14/08/2014, 17:22

Ngày tải lên: 03/11/2012, 11:01

... subdural empyema drainage: A case report. J Med Case Reports 2010, 4:391. 14. Acioly MA, Carvalho CH, Koerbel A, Löwenheim H, Tatagiba M, Gharabaghi A: Intraoperative brainstem auditory evoked potential observations ... that deal only with case reports and of making great efforts to achieve a high qua lity of publi cation also in c ase reports and to stimu- late authors t...

Ngày tải lên: 11/08/2014, 00:23

... discrimination of sepsis and SIRS by determination of circulating plasma concentrations of PCT, IL-6 and C 3a in a medical ICU. Their data indicated that of PCT, IL-6 and C 3a concentrations are more ... K: Discriminative power of inflammatory markers for prediction of tumor necrosis factor-alpha and interleukin-6 in patients with systemic inflammatory response...

Ngày tải lên: 12/08/2014, 19:21

... day 3 of antimicrobial therapy. The indicative accuracy of these varia- bles at day 3 was assessed by calculation of the area under the curve (AUC), as described elsewhere [14]. In medical practice, ... the C-reactive protein ratio during antibiotic therapy. Time-dependent analysis of the C-reactive protein (CRP) ratio dur- ing antibiotic therapy, from day 0 to day 7 of...

Ngày tải lên: 13/08/2014, 08:20

... multivariate analysis, the early, rather than late, use of OLB seems to have a survival advantage. When a patient is intubated and mechanical ventilation is initi- ated as a result of respiratory failure of unknown ... respiratory failure was unclear. This is reflected by the time of OLB after the initiation of mechanical ventilation, which was a median of 11 days in...

Ngày tải lên: 13/08/2014, 08:20

... Parietaria judaica, and Platanus hybrida); mites (Dermatophagoides pteronissynus and D. farinae); moulds (Alternaria alternata and Cladosporium herbarum) and animal danders (cat and dog epithelia). ... and prick-prick tested with fresh ripe peel of Canary variety tomato. All manufactured extracts were kindly supplied by Laborato- rios LETI S.L., Spain. Tomato extracts The Canary...

Ngày tải lên: 13/08/2014, 13:22