Báo cáo y học: "Development and implementation of a performance improvement project in adult intensive care units: overview of the Improving Medicine Through Pathway Assessment of Critical Therapy in Hospital-Acquired Pneumonia (IMPACT-HAP) study" doc
... to all data and take responsibility for the integrity of data and accuracy of data analysis. All authors contributed to analysis and interpretation of data, and to drafting of the manuscript and ... care units: overview of the Improving Medicine Through Pathway Assessment of Critical Therapy in Hospital-Acquired Pneumonia (IMPACT-HAP)...
Ngày tải lên: 14/08/2014, 07:21
... should analyze the data to refine the ECP. The versatility and the ease in upgrading and adjusting the ECP are probably key factors in making ECP widely accepted; 3) The manufacturers are unfortunately ... limited ability to incorporate data and information in decision making and human memory can simultaneously retain and optimally utilize only seven plus or minu...
Ngày tải lên: 18/06/2014, 18:20
... acquisition, analysis and interpretation of the data, and participated in drafting the manuscript. RG partici- pated in the analysis and interpretation of the data. SG con- tributed to the acquisition of ... the conception of the study, and the acqui- sition, analysis and interpretation of the data, and participated in drafting the manuscript. P...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... context, the range of each measure across included footwear was also reported. Intra-rater and inter-rater reliability for all cate- gorical data was evaluated using percentage agreement, and kappa ... mid- soles, lateral and medial midsole hardness items were combined for data analysis. Intra-rater and inter-rater reli- ability for all continuous data were evaluated using intra-...
Ngày tải lên: 10/08/2014, 21:23
Báo cáo y học: "Development and management of systemic lupus erythematosus in an HIV-infected man with hepatitis C and B co-infection following interferon therapy: a case report" doc
... viral load and lymphocytes pre and post therapy. A: summary of therapy. B: lymphocyte subset numbers and C: lymphocyte proportion during ART and in response to splenectomy and anti-retroviral therapy, Interferon -a ... via TLR7 and TLR9 pathways [11], leading to increased pDC migration and maturation [12]. In this case, IFN therapy was most likely the critical...
Ngày tải lên: 11/08/2014, 17:21
Báo cáo y học: " Development and evaluation of an immunochromatographic strip test based on the recombinant UL51 protein for detecting antibody against duck enteritis virus" ppsx
... Veterinary Medicine of Sichuan Agricultural University, Ya’an, Sichuan, 625014, China. 2 Key Laboratory of Animal Diseases and Human Health of Sichuan Province, Ya’an, Sichuan, 625014, China. 3 Epizootic ... (LB) agar medium containing 50 μg/mL kanamycin, and were incubated overnight at 37° C. 200 m L LB medium containing 50 μg/mL kanamycin was inoculated with a freshly grown co...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: "Development and validation of an ELISA using a protein encoded by ORF2 antigenic domain of porcine circovirus type 2" ppsx
... negative serum samples was between 10.16% and 38.26%, with a median value of 31.74%. These data showed that the assay was repeatable and yielded a low and acceptable variation. Evaluation of assay ... to conception, interpretation of data and revision of the manuscript. All authors’ have read and approved the final manuscript. Competing interests The authors decl...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: "Development and Validation of a HPV-32 Specific PCR Assay" pps
... oral examinations of all subjects in the study. MEH: Responsible for obtaining funding for the project and guidance for its direction, and preparation of the manuscript. All authors have read and ... specificity, and reproducibility are critical to the development of any new assay. The sensitivity of the HPV-32 assay was determined using purified HPV-32 DNA...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "Development and validation of molecular markers for characterization of Boehmeria nivea var. nivea and Boehmeria nivea var. tenacissima" pps
... CGCGACAGAGGGGTTTTCTTTCTATTA 1 0.95 SR-S343-R3 AGACGCCTCACTTTGATAGACATGAGTTTA 1 0.89 SNP 50-60 Sn-S62 -a CGACAGTAAACATAAAAACCG 1 1* Sn-S62-b CTGTTACCATTGGCTCTTTACC CAPS 60-67 CP-S62-f TCGTGCGGGTCATAGTACCCCGAGACAAGAGGCCAAAA ... Boehmeria species (Urticaceae), namely Boehmeria nivea var. nivea is a hepatoprotective Chi- nese herbal medicine [1] as well as an antioxidant and anti-inflammat...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: " Development and validation of a complementary map to enhance the existing 1998 to 2008 Abbreviated Injury Scale map" doc
... available. Background In many trauma systems, the Abbreviated Injury Scale (AIS) [1,2] is central to assessing the burden of injury. By assigning a discrete ordinal value to the severity of each injury sustained, ... the ‘enhanced map’. The performance of the enhanced map was evaluated against the performance of the dictionary map alone by using double-coded AI...
Ngày tải lên: 13/08/2014, 23:20