Báo cáo y học: " Increased serum soluble Fas after major trauma is associated with delayed neutrophil apoptosis and development of sepsis" pot

... inflam- matory process [8,9]. The dichotomy between the high adeno- sine levels in the inflamed tissues and the inability of adenosine to hamper the inflammatory process is explained by the increased ... 1 of 9 (page number not for citation purposes) Vol 8 No 1 Research article The PI3K–NF-κB signal transduction pathway is involved in mediating the ant...

Ngày tải lên: 09/08/2014, 07:20

... properly cited. Abstract The objective of this study was to analyse levels of the proinflammatory cytokine macrophage migration inhibitory factor (MIF) in patients with primary Sjögren's syndrome ... with increased γ-globu- Figure 1 Serum levels of macrophage migration inhibitory factor (MIF )Serum levels of macrophage migration inhibitory...

Ngày tải lên: 09/08/2014, 10:20

... infiltrate in B6 mice with collagen-induced arthritisChronic inflammatory infiltrate in B6 mice with collagen-induced arthritis. Histological assessment of arthritis was carried out in early arthritis ... DBA/1 in early arthritis. (b) In B6 mice, the infiltrating cells were predominantly mononuclear in early arthritis and there was less joint erosion. (c) In l...

Ngày tải lên: 09/08/2014, 10:21

... 2 Correlation between soluble Cytotoxic T Lymphocyte Antigen- 4 (sCTLA-4) and clinical index of disease activity Bath Ankylosing Spond-ylitis Disease Activity Index in 165 patients with spondylarthropathiesCorrelation ... spondylarthropathiesCorrelation between soluble Cytotoxic T Lymphocyte Antigen- 4 (sCTLA-4) and clinical index of disease activity Bath Ankylosing Spond...

Ngày tải lên: 09/08/2014, 14:22

... 14:51356853 AGACAGAATGTTGGCTAGTATGTTAGG CTAATTATCTAGATCGCCTTTGACTCC Rsf1 7:104809403-4 GACACTAAAAGTAGAAAGCAGTCACC GCTTTTCTAGCTTTACAATGACTGG Sap30bp 11:115825338 CAACACAGGAAATGGACACG AACCAACAGGACCCAGAGG U1 ... CATCTGCAGGACTGCCTAGC TGGGACTTGACCTCTTCTGC Olfr424 1:176066876 GGACAAAGAATAACACAGATTTTCC GAACAAAGGAATGAAGAAGAGG Olfr573-ps1 7:110091057-8 AGAGGAAGTAGTACATAGGCTCATGG CTACTGAAAGAGTTAACTTAGT...

Ngày tải lên: 09/08/2014, 23:20

... Open Access Preliminary speech recognition results after cochlear implantation in patients with unilateral hearing loss: a case series Yvonne Stelzig 1* , Roland Jacob 1 and Joachim Mueller 2 Abstract Introduction: ... results after cochlear implantation in patients with unilateral hearing loss: a case series. Journal of Medical Case Repor...

Ngày tải lên: 10/08/2014, 23:22

... Reports Open Access Case report Herpes simplex 1 encephalitis presenting as a brain haemorrhage with normal cerebrospinal fluid analysis: a case report Effrossyni Gkrania-Klotsas* 1 and Andrew ML ... subsequent examination by PCR based on studies [9] that have shown that laboratory costs and workload can be substantially when only CSFs with abnormalities ar...

Ngày tải lên: 11/08/2014, 19:21

... provided the original work is properly cited. Research Increased plasma membrane cholesterol in cystic fibrosis cells correlates with CFTR genotype and depends on de novo cholesterol synthesis Danjun ... that Cftr- null cells and tissues exhibit alterations in cholesterol processing including perinuclear cholesterol accumulation, increased de...

Ngày tải lên: 12/08/2014, 11:22

... emphysema, is associated with TNF-α +489G/A gene polymorphism. Keywords: Caucasians, COPD, Gene polymorphism, Susceptibility, Tumor necrosis factor-α Introduction The pro-inflammatory cytokine ... 1 http://respiratory-research.com/content/3/1/29 Kỹỗỹkaycan et al. Research article Tumor Necrosis Factor- +489G/A gene polymorphism is associated with chronic...

Ngày tải lên: 12/08/2014, 18:20

... the efficiency of resources used in a situation of dwindling health care funds and steeply increasing demand. The main objective of this paper is therefore to provide input into an analysis of identifying ... personnel and equipment. The head office of the Ministry of Health and Child Welfare constitutes the high- est level of the public health car...

Ngày tải lên: 13/08/2014, 11:22

... purposes) Clinical and Molecular Allergy Open Access Research Three dimensional structure directs T-cell epitope dominance associated with allergy Scott J Melton* 1 and Samuel J Landry 2 Address: 1 Biomedical ... when analyzed for a population, the dominance of certain epitopes becomes apparent, with some dominant epitopes recognized by a majority of subjects. The CD4+...

Ngày tải lên: 13/08/2014, 13:22

... N -acetylcysteine therapy in late acetaminophen poisoning associated with acute liver failure – a need to be more cautious? T Nimmi C Athuraliya and Alison L Jones Department of Clinical Pharmacology ... The putative protective mechanisms of NAC in late- APAP poisoning and APAP-induced liver failure remain poorly characterised but include free-radic...

Ngày tải lên: 13/08/2014, 16:20

... sepsis. The objective of this study was to investigate the association of variants in the TLR signaling pathway genes and their negative regulator genes with susceptibility to sepsis in the Chinese ... Care 2011, 15:R12 http://ccforum.com/content/15/1/R12 Page 6 of 10 RESEARCH Open Access Variants in the Toll-interacting protein gene are associated wit...

Ngày tải lên: 14/08/2014, 07:21

... injury severity and outcomes are shown in Table 2. Levels of sFas and sFasL in patients with or without sepsis after major trauma Levels of sFas and sFasL were determined in the serum of healthy ... of posttraumatic neutrophil extrinsic apoptosis and the development of sepsis. Methods: Forty-seven major trauma patients, 18 with and 29 without sepsis...

Ngày tải lên: 14/08/2014, 07:21

... et al.: Circulating soluble urokinase plasminogen activator receptor is stably elevated during the first week of treatment in the intensive care unit and predicts mortality in critically ill patients. ... 15:R63 http://ccforum.com/content/15/1/R63 Page 3 of 14 RESEARCH Open Access Circulating soluble urokinase plasminogen activat...

Ngày tải lên: 14/08/2014, 07:21