Báo cáo y học: "Small airway remodeling in acute respiratory distress syndrome: a study in autopsy lung tissue" ppsx

... 15:R4 http://ccforum.com/content/15/1/R4 Page 2 of 12 RESEARCH Open Access Small airway remodeling in acute respiratory distress syndrome: a study in autopsy lung tissue Maina MB Morales 1* , Ruy C Pires-Neto 1 , Nicole Inforsato 1 , ... structural changes in the small air- ways of patients with ARDS, characterized by epithelial denudation, inflammation and airway...

Ngày tải lên: 14/08/2014, 07:21

... lung injury (ALI) and acute respiratory distress syndrome (ARDS) are characterized by increased permeability of the alveolar–capillary barrier, resulting in influx of protein- rich edema fluid and ... 365: 654-657. 57. Krupa A, Kato H, Matthay MA, Kurdowska AK: Proinflammatory activity of anti-IL-8 autoantibody:IL-8 complexes in alveolar edema fluid from patients with Acute Lu...

Ngày tải lên: 12/08/2014, 20:20

... Takaoka ventilator, São Paulo, Brazil). Respiratory rate was adjusted to maintain arterial partial pressure of CO 2 (pCO 2 ) at 40 ± 5 mmHg. A urinary bladder catheter was placed for urinary ... meas- uring protocol was initiated and the infusion of LR was discontinued. A large gastric polyethylene tube was orally introduced and placed in the stomach to allow gastric lavage and draina...

Ngày tải lên: 12/08/2014, 23:23

... nuclear extracts were incubated with avidin–agarose beads (Sigma) at 4 °C for 30 min to eliminate materials in the extracts that bind nonspecifically to the beads. After removing the beads by filtration, ... methods and subjected to autoradiography. A 70-kDa polypeptide is indicated by solid arrowhead. (B) SDS/PAGE analysis of MREa-binding proteins purified by the biotin- avidin method (see...

Ngày tải lên: 17/03/2014, 23:20

... 13 AD3.1 ND.1 AD8.2 AD3.2 ND.2 AD8.1 counts / million ATCTGAGTTGGGAGGGTCCCTCTCCAAA TGTGTCTTGGGGTGGGGGATCAAGACACATTTGGAGAGGGAACCTCCCAACTCGGCCTCTGCCATCAT TAGACACATTTGGAGAGGGAACGTCCCTCTCCAAATGTGTCT TG 0 70 140 210 280 hsa−mir−64 2a ... sequencing data analysis Colo r-sp ace reads were matched against annotated dat a- bases using the Small RNA Analysis P ipeline Tool v 5.0 (RNA2MAP), provided...

Ngày tải lên: 09/08/2014, 23:20

... (rs3761959)) all previously associated with RA in a Japanese population were genotyped in 761 RA samples and 484 controls. In the remaining samples, only the putative disease causal polymorphism, ... Similarly, no association was detected with RA using haplotype analysis or when stratification by shared epitope carriage or by presence of rheumatoid factor was undertaken. This study...

Ngày tải lên: 09/08/2014, 08:22

... primary or secondary dystonia. Painful and repetitive spasms interfere with respiration and may cause metabolic disturbances such as hy perpyrexia, dehydration, respiratory insufficiency, and acute ... in patients with primary or secondary dystonia. Painfu l and repetitive spasms interfere with respiration and may cause metabolic disturbances such as hyperpyrexia, dehydration, respirat...

Ngày tải lên: 11/08/2014, 03:21

... primary or secondary dystonia. Painfu l and repetitive spasms interfere with respiration and may cause metabolic disturbances such as hyperpyrexia, dehydration, respiratory insufficiency, and acute ... secondary dystonia. Painful and repetitive spasms interfere with respiration and may cause metabolic disturbances such as hy perpyrexia, dehydration, respiratory insufficiency, and acute...

Ngày tải lên: 11/08/2014, 07:20

... back pain during the previous two years. Physical examination revealed a typical cushingoid appearance including a ple- thoric moon face, truncal and centripetal obesity and abdominal cutaneous ... Ozlem Yersal Kabayegit* - yersal1978@yahoo.com; Dilek Soysal - dileksoysal@yahoo.com; Gonca Oruk - goncaoruk@deu.edu.tr; Bahar Ustaoglu - baharyakut@yahoo.com; Umut Kosan - umutkosan@yahoo.com...

Ngày tải lên: 11/08/2014, 21:22

... humeral head and of the scapula, and an ultrasound study of the right shoulder, wrist and hand showed a supraspinatus tendinopathy without tendon tears and swelling of radiocarpal and intercarpal ... short-term glucocorticoids, ketamine, muscle relaxants, benzodi- azepines, antidepressants, anticonvulsants, ketanserin, opioids, intensive physical therapy, nerve blocks, sym- pathectomy, in...

Ngày tải lên: 11/08/2014, 21:22