Báo cáo y học: "Validation of a new transpulmonary thermodilution system to assess global enddiastolic volume and extravascular lung wate" pptx
Báo cáo y học: "Validation of a new transpulmonary thermodilution system to assess global enddiastolic volume and extravascular lung wate" pptx
... 14:R209 http://ccforum.com/content/14/6/R209 Page 3 of 8 RESEARC H Open Access Validation of a new transpulmonary thermodilution system to assess global end- diastolic volume and extravascular lung water Karim Bendjelid 1* , Raphael Giraud 1 , ... Siegenthaler 1 , Frederic Michard 2 Abstract Introduction: A new system has been developed to assess global...
Ngày tải lên: 14/08/2014, 07:21
Báo cáo y học: " Implementation of a new emergency medical communication centre organization in Finland an evaluation, with performance indicators"
... Handbooks of the Ministry of Social Affairs and Health Ambulance and emergency care services: A handbook for drawing up an alarm procedure. Finland Helsinki; 2005, 56. 7. Kuisma K, Boyd J, Väyrynen ... - an evaluation, with performance indicators. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine 2011 19:19. Submit your next manuscript to BioMed Central and...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... PRIMARY RESEARCH Open Access Validation of a specific measure to assess health- related quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ ... = ‘TOlerability and quality Of Life’; YMRS = Young Mania Rating Scale. Montejo et al. Annals of General Psychiatry 2011, 10:6 http://www.annals-general-psychiatry.com/conten...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx
... chronobiology. Since this type of research generally requires a large amount of data from several weeks of monitoring, the use of automatic systems is necessary. Various types of automatic systems to measure ... designed and validated several years ago. The new apparatus allows easier recording of animals by means of a battery of radar devices housed in specific ele-...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: " Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region" pdf
... CP70-for (GGTTGTGAAGGNCCNTGTAAGGTYCA) and SL2 150-rev (GCWGCAAAGACACCAAYGCCGT) were uti- lized to amplify a complementary and partially over- lapped DNA -A segment . Amplification of DNA-B sequences was performed ... subsequently scored for the appearance of disease symptoms. The infectio n status of the inoculated plants was assessed by visual inspection of symptoms and by...
Ngày tải lên: 12/08/2014, 01:22
Báo cáo y học: " Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ-PCR) for the quantification of HBV-DNA" pot
... We report a new ultra sensitive real time PCR molecular beacon based assay with remarkable analytical and clinical sensitivity, calibrated against the WHO 1 st International standard. Background Chronic ... detection system, with remarkable analytical and clinical sensitivity, calibrated against the WHO 1 st International standard. Acknowledgements This study was supported by Gilead....
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... ten days. Comparison between pre- and post-raltegravir viral load measurements was done. Viral load values at Day 0, Day 7 and Day 10 were compared with viral loads at 27 and 166 days prior to treatment ... primer), SIV2-D 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCA- GAAAGCCTGTTGGA-TAMRA (TaqMan probe). The signal was finally compared to a standard curv...
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: "Characterization of a new simian immunodeficiency virus strain in a naturally infected Pan troglodytes troglodytes " ppt
... performed all molecular, phylogenetic and diversity analyses with the contribution of AA. EN, NW, ML, and UT initiated and coordinated collaboration between Yaoundé Zoo/Sanctuary and the laboratory of ... Lutwama F, Serwadda R, Mayanja-Kizza H, Shihab HM, Ronald A, Kamya MR, Thomas D, Johnson E, Quinn TC, Moore RD, Spacek LA: Evaluation of Dynabeads and Cytospheres compared w...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Isolation of a new HIV-2 group in the US" pptx
... that the patient was HIV-2 infected and provided valuable demo- graphic data. RG, AG, CA, and PAM amplified gag and per- formed the phylogenic analysis. All authors read and approved the final ... van der, Awasana AA, Sarge-Njie R, Sande M van der, Jaye A, Sabally S, et al.: Sixteen years of HIV surveillance in a West African research clinic reveals divergent epidemic trends of...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot
... 5'-TGCAAATAAAT- GG ATCCAACAAGTAGCAAAAGT-3' (nt 5968 to 6000). Mutagenic primers 5'-GGGACAGCAAGC TAAGTATCAA- 3' (nt 6113 to 6134) and 5'-TATCAACCCCAGC TAAG- TAAGCAA-3' (nt 6129 to 6152) were used to ... Forward primer M5e (5'-GGAATTCATGGATGCTGGGGCCAGATAC-3'; nt 6012 to 6032) and reverse primer M3b (5'-CGGGATCCG- CAAGCAGCAAGCTTCTCCTTATA...
Ngày tải lên: 13/08/2014, 06:20