Báo cáo y học: "Differences in trauma team activation criteria among Norwegian hospitals" doc

Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

... raises the possibility that any one or a combination of these properties may in uence the binding of apolipoproteins to lipoprotein particles. The capacity to fractionate lipid emulsions into relatively ... apolipoprotein E3 and E4 to emulsions (Eur. J. Biochem. 269) 5941 Differences in the binding capacity of human apolipoprotein E3 and...

Ngày tải lên: 08/03/2014, 09:20

11 600 0
Báo cáo y học: "Autoantibodies in normals – the value of predicting rheumatoid arthrits" doc

Báo cáo y học: "Autoantibodies in normals – the value of predicting rheumatoid arthrits" doc

... precise “window of opportunity” for early and Viewpoint Autoantibodies in normals – the value of predicting rheumatoid arthritis Thomas Dörner and Arne Hansen Charite University Medicine Berlin, Free ... early indicators of a definite break in tolerance and may provide insight into the pathogenesis of RA. This raises the possibility to predict RA development in...

Ngày tải lên: 09/08/2014, 06:22

3 320 0
Báo cáo y học: "Developments in the scientific and clinical understanding of gout" docx

Báo cáo y học: "Developments in the scientific and clinical understanding of gout" docx

... prosperity and increased life expectancy and age of the population. Uric acid metabolism Uric acid is the end result of the purine metabolic pathway and the product of the conversion of xanthine, by the ... http://arthritis-research.com/content/10/5/221 Abstract Gout is the most common form of inflammatory arthritis in the elderly. In the last two decades...

Ngày tải lên: 09/08/2014, 13:22

6 350 0
Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps

Báo cáo y học: " Differences in the ability to suppress interferon b production between allele A and allele B NS1 proteins from H10 influenza A viruses" pps

... identity and 66-70% amino acid identity was found between the < /b> NS1 proteins. The < /b> NS allele A is more common and is the < /b> only subtype found in < /b> mammalian-adapted isolates. In < /b> a comparison between amino ... forward 5’ GGCCATGACCAACAAGTGTCTCCTCC 3’ and reverse 5’ ACAGGTTACCTCCGAAACTGAGCGC 3’ , resulting a product of 550 bp; and b- actin for...

Ngày tải lên: 11/08/2014, 21:21

8 348 0
Báo cáo y học: " Differences in allergen-induced T cell activation between allergic asthma and rhinitis: Role of CD28, ICOS and CTLA-4" potx

Báo cáo y học: " Differences in allergen-induced T cell activation between allergic asthma and rhinitis: Role of CD28, ICOS and CTLA-4" potx

... 4). Discussion The results of our ex vivo studystronglysuggestacon- trasted picture of T cell activation in allergic rhinitis and asthma, with distinct patterns of Th1, Th2 and Treg profiles and expression ... after stimulation with irrelevant rBetv1 (not shown). Role of co-receptor engagement In order to study the respective role of CD28, ICOS and CTLA-...

Ngày tải lên: 12/08/2014, 13:22

10 292 0
Báo cáo y học: " Differences in susceptibility to German cockroach frass and its associated proteases in induced allergic inflammation in mice" pot

Báo cáo y học: " Differences in susceptibility to German cockroach frass and its associated proteases in induced allergic inflammation in mice" pot

... Access Research Differences in susceptibility to German cockroach frass and its associated proteases in induced allergic inflammation in mice Kristen Page* 1,3 , Kristin M Lierl 1 , Nancy Herman 2 and Marsha ... purposes) GC frass serine proteases regulate airway inflammation and airway hyperresponsiveness in Balb/c miceFigure 4 GC frass serine...

Ngày tải lên: 12/08/2014, 15:21

12 392 0
Báo cáo y học: " Differences in the mannose oligomer specificities of the closely related lectins from Galanthus nivalis and Zea mays strongly determine their eventual anti-HIV activity" pdf

Báo cáo y học: " Differences in the mannose oligomer specificities of the closely related lectins from Galanthus nivalis and Zea mays strongly determine their eventual anti-HIV activity" pdf

... 8:10 http://www.retrovirology.com/content/8/1/10 Page 3 of 16 RESEARCH Open Access Differences in the mannose oligomer specificities of the closely related lectins from Galanthus nivalis and Zea mays strongly determine their eventual anti-HIV ... the mannose oligomer specificities of the closely related lectins from Galanthus...

Ngày tải lên: 13/08/2014, 01:20

16 319 0
Báo cáo y học: "Lost in translation? The pursuit of lung-protective ventilation" doc

Báo cáo y học: "Lost in translation? The pursuit of lung-protective ventilation" doc

... albeit in conjunction with existing data – supportive of further study and potentially, a therapeutic trial. The incidence of ALI/ARDS in the study by the Irish Critical Care Trials Group, 27% of ... for the discussion and advancement of clinical critical care practice. The data regarding statin use are tantalizing, and add to the growing debate and interest regarding...

Ngày tải lên: 13/08/2014, 08:21

3 154 0
Báo cáo y học: "Differences in HIV-related behaviors at Lugufu refugee camp and surrounding host villages, Tanzania" ppsx

Báo cáo y học: "Differences in HIV-related behaviors at Lugufu refugee camp and surrounding host villages, Tanzania" ppsx

... implications. Sev- eral findings point to the need for interventions that address HIV -behaviors in the younger age groups, espe- cially in the refugee population. This includes training, education, ... Secondly, recall bias is an important limitation in any study that includes ret- rospective questions. Thirdly, re-sampling in the camp was necessary due to repatriation and the...

Ngày tải lên: 13/08/2014, 13:21

14 276 0
Báo cáo y học: "GAS6 in systemic inflammatory diseases: with and without infection" docx

Báo cáo y học: "GAS6 in systemic inflammatory diseases: with and without infection" docx

... including severe sepsis, sepsis, systemic in ammatory response syn drome without infection, and verifi ed infection – blood donors, systemic in ammatory res ponse syndrome patients with infections, ... research, including genetic screenings of the components of this system. â 2010 BioMed Central Ltd GAS6 in systemic in ammatory diseases: with and without infection...

Ngày tải lên: 13/08/2014, 21:21

2 205 0
Báo cáo y học: "Differences in organ dysfunctions between neonates and older children: a prospective, observational, multicenter study" pot

Báo cáo y học: "Differences in organ dysfunctions between neonates and older children: a prospective, observational, multicenter study" pot

... neonates and adults [14,15]. In neonates with MODS, there is an early and prominent microvascular failure, characterized by a generalized capillary leak and anasarca, followed by renal and hepatic dysfunctions, while ... and interpretation of data and to drafting the article. AD contributed to analysis and interpretation of data and to drafting the article and prov...

Ngày tải lên: 13/08/2014, 21:21

9 246 0
Báo cáo y học: "Differences in trauma team activation criteria among Norwegian hospitals" doc

Báo cáo y học: "Differences in trauma team activation criteria among Norwegian hospitals" doc

... Scale) Hypotension Misc. respiratory symptoms Ventilation rate Pulse rate ANATOMIC INJURY Penetrating injury Burn injury Two large fractures Crush injury Pelvic injury Flail chest Inhalation injury Large ... function? Yes or No Has the hospital performed trauma team training according to the BEST 1 guidelines? Yes or No If yes, when was the first training? Date Have you been training dur...

Ngày tải lên: 13/08/2014, 23:21

10 185 0
Báo cáo y học: "Anemia in the ICU: are your patients needin’ erythropoetin" doc

Báo cáo y học: "Anemia in the ICU: are your patients needin’ erythropoetin" doc

... as there is a demonstrated mortality benefi t, but these patients should be able to safely receive prophylactic heparin. Competing interests The authors declare that they have no competing interests. Published: ... however, are not entirely conclusive. With further analysis, the authors showed that the increase in throm botic events only aff ected patients not receiving hepari...

Ngày tải lên: 14/08/2014, 07:21

2 192 0
Báo cáo y học: "Transfusion in trauma: thromboelastometry-guided coagulation factor concentrate-based therapy versus standard fresh frozen plasma-based therapy" ppsx

Báo cáo y học: "Transfusion in trauma: thromboelastometry-guided coagulation factor concentrate-based therapy versus standard fresh frozen plasma-based therapy" ppsx

... RESEARCH Open Access Transfusion in trauma: thromboelastometry-guided coagulation factor concentrate-based therapy versusstandardfreshfrozenplasma-basedtherapy Herbert Schöchl 1,2 , Ulrike Nienaber 3 , ... in trauma: thromboelastometry-guided coagulation factor concentrate-based therapy versus standard fresh frozen plasma-based therapy. Critical Care 201...

Ngày tải lên: 14/08/2014, 07:21

9 216 0
Báo cáo y học: "Variation in tissue-specific gene expression among natural populations" ppt

Báo cáo y học: "Variation in tissue-specific gene expression among natural populations" ppt

... A2 y F4 Cystathionine beta synthase Cystathionine-beta-synthase z K11 Cold inducible RNA binding Cold inducible RNA-binding protein; (CIRBP) glycine-rich RNA binding protein; aa F2 Hepatocyte ... binding H6 Fatty acid binding protein H6-isoform tt O10 Fatty acid binding heart Heart-type fatty acid-binding protein (H-FABP) uu D9 Fatty acid syn Fatty acid synthase vv F9 Glutamate decarboxylas...

Ngày tải lên: 14/08/2014, 14:21

14 211 0
Từ khóa:
w