Báo cáo y học: "Inter-hospital transfer: the crux of the trauma system, a curse for trauma registries" docx
Báo cáo y học: "Inter-hospital transfer: the crux of the trauma system, a curse for trauma registries" docx
... Recommendations for uniform reporting of data
following major trauma the Utstein style. A report of a working party of
the International Trauma Anaesthesia and Critical Care Society (ITACCS).
Resuscitation ... Rehn
1,3
Abstract
The inter-hospital transfer of patients is crucial to a well functioning trauma system, and the transfer process may
serve as a quality...
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"
... VARA data were used only
to capture the DAS28, the CDAI and other clinical characteristics measured at the baseline and
outcome VARA visits; all other data used for the analysis were from the ... pharmacy data. While clinical
disease activity measures remain the gold standard for assessing effectiveness in RA, the many
large administrative data sources in the U.S. and...
Tài liệu Báo cáo khoa học: Electron transfer chain reaction of the extracellular flavocytochrome cellobiose dehydrogenase from the basidiomycete Phanerochaete chrysosporium doc
... transfer chain reaction of CDH K. Igarashi et al.
2872 FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS
5¢-TCAGCGTTCTCGGAATTC-3¢; AP2-Xba-R, 5¢-TTTT
ACAGTAATATAAAGAATTTCGCTCTAGATCAAGGA
CCTCCCGCAAGCGCGAG-3¢; ... reduction. These results are essen-
tially the same as those for the WT enzyme [24] and
suggest that both flavin and heme are active in the
mutant enzyme.
Presteady-state and ste...
Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx
... PtdIns
by the Arabidopsis enzyme will allow us to carry out a
deeper study of this particular activity of the protein.
Effect of EDTA on PtdIns synthase reactions
Our data show that at free manganase ... therefore arises from
an exchange reaction.
Effect of EDTA on the enzymatic activities
of PtdIns synthase
The net activity of PtdIns synthase as an exchange enzyme
stimu...
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx
... exponential growth; it
starts to accumulate at the early stationary phase, and its
steady-state level increases further during the late stationary
phase. As a result of this accumulation, the relative ... insets). The ability of the mutant strain to
resume growth after the stationary phase was then compared
with that of the parental strain. As shown in Fig. 6A, after
tra...
Báo cáo Y học: Expression and purification of the recombinant subunits of toluene/ o-xylene monooxygenase and reconstitution of the active complex potx
... transfer
electrons, can be attributed to its capacity to modulate the
activity of the hydroxylase component of the complex, as it
Table 1. Single-turnover assays catalyzed by the components of ... were analyzed by MALDI/MS. The mass signals
recorded in the spectra were mapped onto the anticipated
sequence of subunit C on the basis of their mass value and
the specifi...
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx
... in a yield of
20% of the LPS mass.
Rabbit antisera and serological assays
Polyclonal O-antisera were obtained by immunization of
rabbits with heat-inactivated bacteria of P. penneri 1and4
according ... 75%.
Comparison of the
13
C NMR spectra of the initial and
O-deacetylated polysaccharides from P. penneri 4 showed
that in the former a part of the signals for C5...
Báo cáo Y học: Synthesis and turn-over of the replicative Cdc6 protein during the HeLa cell cycle potx
... and
used for the extraction of DNA. E xtracted DNA was
analysed by PAGE and ethidium bromide st aining.
Preparation and use of antibodies
A cDNA sequence encoding a 30-kDa-fragment (amino-
acid residues ... phase entry [27]. Therefore,
phosphorylation may be necessary for a S-phase related
function of hCdc6p, e.g. the activation of late origins.
Because phosphorylation a...
Báo cáo Y học: Purification and properties of the extracellular lipase, LipA, of Acinetobacter sp. RAG-1 docx
... 3.1.1.3) that
catalyze the hydrolysis of triacylglycerols to free fatty acids
and glycerol. They resemble esterases in catalytic activity,
but differ in that their substrates are water-insoluble fats
containing ... and
sequence analysis of the lipase and lipase chaperone- encoding
genes from Acinetobacter calcoaceticus RAG-1, and redefinition of
a proteobacterial lipase family and...
Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc
... hA2aR (M -A2 aTr316-H10)
binds speci®cally and quantitatively to a XAC-agarose gel. Shown is a
section of a 10% silver-stained SDS/PAGE gel. Lane 1 , 0.4 lgofthe
fraction loaded onto the XAC-agarose ... °C.
Synthesis of XAC-agarose gel
The ligand af®nity gel was prepared based on the method
described by Nakata [15]. XAC was dissolved in dimethyl-
sulfoxide at a con centratio...