Báo cáo y học: "Inter-hospital transfer: the crux of the trauma system, a curse for trauma registries" docx

Báo cáo y học: "Inter-hospital transfer: the crux of the trauma system, a curse for trauma registries" docx

Báo cáo y học: "Inter-hospital transfer: the crux of the trauma system, a curse for trauma registries" docx

... Recommendations for uniform reporting of data following major trauma the Utstein style. A report of a working party of the International Trauma Anaesthesia and Critical Care Society (ITACCS). Resuscitation ... Rehn 1,3 Abstract The inter-hospital transfer of patients is crucial to a well functioning trauma system, and the transfer process may serve as a quality...

Ngày tải lên: 13/08/2014, 23:21

3 219 0
Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"

Báo cáo y học: " Derivation and preliminary validation of an administrative claims-based algorithm for the effectiveness of medications for rheumatoid arthritis"

... VARA data were used only to capture the DAS28, the CDAI and other clinical characteristics measured at the baseline and outcome VARA visits; all other data used for the analysis were from the ... pharmacy data. While clinical disease activity measures remain the gold standard for assessing effectiveness in RA, the many large administrative data sources in the U.S. and...

Ngày tải lên: 25/10/2012, 10:45

29 582 0
Tài liệu Báo cáo khoa học: Electron transfer chain reaction of the extracellular flavocytochrome cellobiose dehydrogenase from the basidiomycete Phanerochaete chrysosporium doc

Tài liệu Báo cáo khoa học: Electron transfer chain reaction of the extracellular flavocytochrome cellobiose dehydrogenase from the basidiomycete Phanerochaete chrysosporium doc

... transfer chain reaction of CDH K. Igarashi et al. 2872 FEBS Journal 272 (2005) 2869–2877 ª 2005 FEBS 5¢-TCAGCGTTCTCGGAATTC-3¢; AP2-Xba-R, 5¢-TTTT ACAGTAATATAAAGAATTTCGCTCTAGATCAAGGA CCTCCCGCAAGCGCGAG-3¢; ... reduction. These results are essen- tially the same as those for the WT enzyme [24] and suggest that both flavin and heme are active in the mutant enzyme. Presteady-state and ste...

Ngày tải lên: 19/02/2014, 18:20

9 514 0
Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx

Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx

... PtdIns by the Arabidopsis enzyme will allow us to carry out a deeper study of this particular activity of the protein. Effect of EDTA on PtdIns synthase reactions Our data show that at free manganase ... therefore arises from an exchange reaction. Effect of EDTA on the enzymatic activities of PtdIns synthase The net activity of PtdIns synthase as an exchange enzyme stimu...

Ngày tải lên: 22/02/2014, 04:20

6 552 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

... exponential growth; it starts to accumulate at the early stationary phase, and its steady-state level increases further during the late stationary phase. As a result of this accumulation, the relative ... insets). The ability of the mutant strain to resume growth after the stationary phase was then compared with that of the parental strain. As shown in Fig. 6A, after tra...

Ngày tải lên: 22/02/2014, 07:20

9 548 0
Báo cáo Y học: Expression and purification of the recombinant subunits of toluene/ o-xylene monooxygenase and reconstitution of the active complex potx

Báo cáo Y học: Expression and purification of the recombinant subunits of toluene/ o-xylene monooxygenase and reconstitution of the active complex potx

... transfer electrons, can be attributed to its capacity to modulate the activity of the hydroxylase component of the complex, as it Table 1. Single-turnover assays catalyzed by the components of ... were analyzed by MALDI/MS. The mass signals recorded in the spectra were mapped onto the anticipated sequence of subunit C on the basis of their mass value and the specifi...

Ngày tải lên: 17/03/2014, 10:20

11 478 0
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx

... in a yield of 20% of the LPS mass. Rabbit antisera and serological assays Polyclonal O-antisera were obtained by immunization of rabbits with heat-inactivated bacteria of P. penneri 1and4 according ... 75%. Comparison of the 13 C NMR spectra of the initial and O-deacetylated polysaccharides from P. penneri 4 showed that in the former a part of the signals for C5...

Ngày tải lên: 17/03/2014, 17:20

6 562 0
Báo cáo Y học: Synthesis and turn-over of the replicative Cdc6 protein during the HeLa cell cycle potx

Báo cáo Y học: Synthesis and turn-over of the replicative Cdc6 protein during the HeLa cell cycle potx

... and used for the extraction of DNA. E xtracted DNA was analysed by PAGE and ethidium bromide st aining. Preparation and use of antibodies A cDNA sequence encoding a 30-kDa-fragment (amino- acid residues ... phase entry [27]. Therefore, phosphorylation may be necessary for a S-phase related function of hCdc6p, e.g. the activation of late origins. Because phosphorylation a...

Ngày tải lên: 17/03/2014, 23:20

7 555 0
Báo cáo Y học: Purification and properties of the extracellular lipase, LipA, of Acinetobacter sp. RAG-1 docx

Báo cáo Y học: Purification and properties of the extracellular lipase, LipA, of Acinetobacter sp. RAG-1 docx

... 3.1.1.3) that catalyze the hydrolysis of triacylglycerols to free fatty acids and glycerol. They resemble esterases in catalytic activity, but differ in that their substrates are water-insoluble fats containing ... and sequence analysis of the lipase and lipase chaperone- encoding genes from Acinetobacter calcoaceticus RAG-1, and redefinition of a proteobacterial lipase family and...

Ngày tải lên: 23/03/2014, 21:20

9 460 0
Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

... hA2aR (M -A2 aTr316-H10) binds speci®cally and quantitatively to a XAC-agarose gel. Shown is a section of a 10% silver-stained SDS/PAGE gel. Lane 1 , 0.4 lgofthe fraction loaded onto the XAC-agarose ... °C. Synthesis of XAC-agarose gel The ligand af®nity gel was prepared based on the method described by Nakata [15]. XAC was dissolved in dimethyl- sulfoxide at a con centratio...

Ngày tải lên: 24/03/2014, 00:21

11 583 0
w