Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A valuable tool for establishing a pan-European dataset" docx
Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A joint revision by SCANTEM, TARN, DGU-TR and RITG" ppt
... Trauma Registry Standard (KVITTRA), Data Dictionary. 5 The Norwegian National Trauma Registry, Data Dictionary. 6 American College of Surgeons, National Trauma Data Bank; National Trauma Data ... model variables. Data variable no. Data variable name Type of data Data variable categories or values Definition of data variable 1 Age Continuous Number The patient's age...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A valuable tool for establishing a pan-European dataset" docx
... statistical and data- mining techniques allow for the combination of such databases, the management of missing data and the sensible exploration of large-scale data. For now, both approaches are valid. ... Physiological data, drug and blood product administration can all be tagged electroni- cally, as can the patient's position within the hospital. Other databases, such as...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo Y học: The Emery–Dreifuss muscular dystrophy associated-protein emerin is phosphorylated on serine 49 by protein kinase A pptx
... Professor. References 1 Nagano A, Koga R, Ogawa M, Kurano Y, Kawada J, Okada R, Hayashi YK, Tsukahara T & Arahata K (1996) Emerin deficiency at the nuclear membrane in patients with Emery–Dreifuss muscular dystrophy. ... 8.0 (ALP buffer) and immediately desalted and analyzed by Q-TOF mass spectrometry. For peptide analysis, MALDI TOF MS (REFLEX II, Bruker–Daltonics, Bremen, Germany) wi...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo y học: " The PIN-FORMED (PIN) protein family of auxin transporter" doc
... Species abbreviations: At, Arabidopsis thaliana; Alyr, Arabidopsis lyrata; Bradi, Brachypodium distachyon; Cpap, Carica papaya; Glyma, Glycine maxima; Mtru, Medicago truncatula; Osat, Oryza sativa; ... plants Streptophyta Rhodophyta - red algae Glaucophyta Archaeplastida - plantae sensu lato Plantae sensu stricto Chlorophyta (majority of green algae) Mesostigma, Chlorokybus clade Klebsorm...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo y học: "The International Sepsis Forum’s controversies in sepsis: my initial vasopressor agent in septic shock is norepinephrine rather than dopamine" pot
... α 1 -adrenergic agonist action predominates. The American College of Critical Care Medicine and the Society of Critical Care Medicine in 1999 published practice parameters for the hemodynamic management ... Diego, USA, in January 2002. For more information about ISF, see: http://www.sepsisforum.org. References 1. Anonymous: Practice parameters for hemodynamic support of sepsis in...
Ngày tải lên: 12/08/2014, 19:21
Báo cáo y học: "The aryl hydrocarbon receptor-mediated disruption of vitellogenin synthesis in the fish liver: Cross-talk between AHR- and ERα-signalling pathway" ppt
... Kitagawa H, Yamamoto Y, Nohara K, Tohyama C, Krust A, Mimura J, Chambon P, Yanagisawa J, Fujii-Kuriyama Y, Kato S: Modulation of oestrogen receptor sig- nalling by association with the activated ... viability of the cells after each treatment was always over 90%, as determined by the Trypan blue exclusion assay. RNA purification, Northern and slot blot analysis Total cellular RNA was...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "The validity, reliability and normative scores of the parent, teacher and self report versions of the Strengths and Difficulties Questionnaire in China" doc
... the database of the raw data in FoxPro; data description and statistical analyses were performed by SPSS (versions 11.0 and 14.0). Statistical analyses were Child and Adolescent Psychiatry and ... report questionnaires can potentially play an important role in this process. A range of questionnaires are available to evaluate behavioural and emotional problems of children and adole...
Ngày tải lên: 13/08/2014, 18:21
Báo cáo y học: "The short-term safety and efficacy of fluoxetine in depressed adolescents with alcohol and cannabis use disorders: a pilot randomized placebo-controlled trial" potx
... robert.findling@uhhospitals.org; Maria E Pagano - maria.pagano@uhhospitals.org; Nora K McNamara - nora.mcnamara@uhhospitals.org; Robert J Stansbrey - robert.stansbrey@uhhospitals.org; Jon E Faber - jon.faber@uhhospitals.org; ... received placebo. Unfortunately, there are little data available regarding the pharmacological treatment of depressed youths with comorbid substance use disorde...
Ngày tải lên: 13/08/2014, 18:21
Báo cáo y học: "The ASRG database: identification and survey of Arabidopsis thaliana genes involved in pre-mRNA splicing" doc
... TTGTCCCACATCGGTTAAGAATTCCGTTTAGGTGAAGTATATATATGTTTACATACGGAA atU6atac2 At1g21395 TAATACCGCATCGGAACTTTGGTAGTTTTTGGTTT-GTGTATATATATAGAAAGACTAGT atU6atac At5g40395 CAATT-GATTGTGTTCGTAGAAAGGAGAGATGGTTGGCATCTCCTCTGACAGAGACGGGA ... CAATT-GATTGTGTTCGTAGAAAGGAGAGATGGTTGGCATCTCCTCTGACAGAGACGGGA atU6atac2 At1g21395 GGATTCGATTGTGTTCATAGAAAGGAGAGATGGTTGGCATCTCCTCTGACAGAGACGGGG hsU6atac U62823 GTG...
Ngày tải lên: 14/08/2014, 14:21
Báo cáo y học: "Integrated miRNA and mRNA expression profiling of mouse mammary tumor models identifies miRNA signatures associated with mammary tumor lineage" docx
... genetic alterations in breast carcinogenesis. PLoS One 2010, 5: e14078. 31. Taniguchi K, Ishizaki T, Ayada T, Sugiyama Y, Wakabayashi Y, Sekiya T, Nakagawa R, Yoshimura A: Sprouty4 deficiency potentiates ... with quality control and analysis. MY and RS normalized the data and performed all statistical analyses. CD and DM provided tumor tissue samples that they had characterized. JEG conc...
Ngày tải lên: 09/08/2014, 23:20