Báo cáo y học: "EMS-physicians’ self reported airway management training and expertise; a descriptive study from the Central Region of Denmark" docx
Báo cáo y học: "EMS-physicians’ self reported airway management training and expertise; a descriptive study from the Central Region of Denmark" docx
... except the Airtraq and the ILMA areavailable in all sizes from neonatal to large adult. Forconfirmation of correct laryngeal tube placement allunits hav e capnography available, and all ha ve ... maintenance and quality controlfor emergency medical service personnel. The aim of this study was to provide data regarding airway management- training and expertise from the regional physician-staffed ... procedures may be neededas the lack of equipment awareness may pose a threatto patient safety. The physicians training with the airway devices isin general satisfactory and in line with what hasbeen...
- 7
- 357
- 0
Báo cáo y học: "Cricothyroidotomy for elective airway management in critically ill trauma patients with technically challenging neck anatomy" pps
... patient was endotracheally intubated beyond21 days prior to placement of the surgical airway (Table 1).DiscussionTranslaryngeal intubation is the mainstay for temporary airway management. Early experience ... information about our standard of care airway man-agement for critically ill trauma patients with ventilator depen-dence during the study period. The standard of care was a standard tracheostomy ... midsection of the anterior neck.This approach is technically much easier and faster, and thuscricothyroidotomy has found its place as the standard emer-gency airway in situations when translaryngeal...
- 5
- 356
- 0
Báo cáo y học: "Pre-hospital advanced airway management by anaesthesiologists: Is there still room for improvement?" potx
... HEMSphysicians to see how they evaluate the quality and safety of their own pre-hospital airway management. Such a sur-vey could create a basis for further risk management and quality improvement ... airway management by the Scandinavian Society for Anaesthesiology and Intensivecare medicine (SSAI)[6]. These guidelines stress the importance of extensive airway management experience and the ability ... practice alone is no guarantee that the desiredlevel of skills proficiency in advanced and difficult airway management would be acquired and maintained[11,17,18]. The frequency of airway management...
- 7
- 254
- 0
Báo cáo y học: " Mild autonomic dysfunction in primary Sjögren''''s syndrome: a controlled study" pptx
... had a positive labial salivary gland biopsy. The average age of onset of disease was 48 years (range 29 to 73 years) and the aver-age disease duration was 13 years (range 2 to 29 years).All participants ... with the study design and patient ascertainment. MR conceived of the study, participated in its design and coordination and draft-ing of the manuscript. All authors read and approved the finalmanuscript.AcknowledgementsThis ... analysis.Analysis was performed by analysis of variance (ANOVA),multivariate ANOVA and repeated measures ANOVA, asindicated. Factor analysis was utilized to detect relationshipsbetween positive autonomic...
- 10
- 922
- 0
Báo cáo y học: " Vasoactive intestinal peptide inhibits TNF-α-induced apoptotic events in acinar cells from nonobese diabetic mice submandibular glands" docx
... TNF-α-induced apoptotic events through a cAMP-mediated pathway.Materials and methodsAnimalsNOD and BALB/c female mice were bred and maintained in the Central Animal Care Facility at the School of Exact ... protocols of the Ani-mal Care and Use Committee of the School of Exact and Nat-ural Sciences, University of Buenos Aires, Argentina.Submandibular acinar cell isolation and treatmentsSubmandibular ... was deter-mined by radioimmunoassay and amylase by means of an enzymatic assay as described in Material and methods. *P < 0.05 vs. basal. (c) Bax mRNA expression levels were determined after...
- 10
- 232
- 0
Báo cáo y học: "New onset diabetes complicated by haemolysis and rhabdomyolysis: a case report and review of the literature" pot
... methaemoglobinaemia and creatine kinase in the early identification of G6PD deficiency and rhabdomyol-ysis.Case presentation A 54-year-old Kenyan man presented with a 3-day history of reduced appetite, weakness ... whichwas complicated by haemolysis secondary to G6PD defi-ciency and rhabdomyolysis. This case highlights the importance of simple laboratory investigations, such asmethaemoglobinaemia and serial ... 1). In the presence of the haemolysis and methaemoglobinaemia, G6PD and pyruvate kinaseassays were performed. A diagnosis of G6PD deficiency3.9 IU/gHb (5.2 to 11.5) and low pyruvate kinase 10.2...
- 4
- 529
- 0
Báo cáo y học: " Nontypeable Haemophilus influenzae induces COX-2 and PGE2 expression in lung epithelial cells via activation of p38 MAPK and NF-kappa B" pps
... p38 MAPK and NF-kappa B may affectCOX-2 expression in human airway myocytes via separatesignaling pathways given the fact that SB203580 did notaffect cytokine-stimulated IkappaBalpha degradation ... humanCOX-1, COX-2 and GAPDH (an internal control). COX-1:forward: 5' AGTACCGCAAGAGGTTTGGC 3', reverse: 5'GCCGTCTTGACAATGTTAAAGC 3'; COX-2: forward: 5'GACAGTCCA CCAACTTACAAT ... Relative quantity of mRNAs were obtained by using the comparative Ctmethod and was normalized by using TaqMan predevel-oped assay reagent human cyclophilin and mouseGAPDH for human COX-2 and...
- 9
- 290
- 0
Báo cáo y học: "What patients think about ICU follow-up services: a qualitative study" doc
... included in the analysis. N6 software wasused to facilitate a comparison of themes across the entiredataset. Our analysis reveals new patient perspectives that areunlikely to appear in standard questionnaires ... ICUstaff about their experiences of healthcare and quality of lifeafter ICU treatment, data not only important for audit and research but also to the overall job satisfaction and morale of ICU ... provide data onmortality and health-related quality of life measures after ICUstay and hospital discharge, and data for monitoring serviceprovision. Many participants valued giving feedback to...
- 10
- 265
- 0
Báo cáo y học: "Endothelial Real-time ultrasound-guided percutaneous dilatational tracheostomy: a feasibility study" doc
... the trachea was per-formed to permit clear visualization of the needle pathup to the midline of the anterior wall of the trachea. Onaxial imaging, the airway in the neck is immediatelyapparent ... Yilmaz M, Gurpinar F, Ramazanoglu A: The use of the laryngeal mask airway as an alternative to the endotracheal tube duringpercutaneous dilatational tracheostomy. Intensive Care Med 2002,28:63-67.32. ... Sinha PK, Tripathi M, Matreja P: Laryngeal mask airway vsendotracheal tube to facilitate bedside percutaneous tracheostomy incritically ill patients: a prospective comparative study. J Postgrad...
- 10
- 230
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ