Báo cáo y học: " Current use of intraosseous infusion in Danish emergency departments: a cross-sectional study" ppsx

Báo cáo y học: " Current use of intraosseous infusion in Danish emergency departments: a cross-sectional study" ppsx

Báo cáo y học: " Current use of intraosseous infusion in Danish emergency departments: a cross-sectional study" ppsx

... this article as: Molin et al., Current use of intraosseous infusion in Dan- ish emergency departments: a cross-sectional study Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... Emergency Medicine [10] and training in the subspecialty of emergency medicine in Denmark [11]. Lack of training in IOI use in Danish EDs, indicates a...

Ngày tải lên: 13/08/2014, 23:20

5 242 1
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx

... TGCTTCATCTTG CTGACGTGTACGTGGGACT C27 1A ATGTGTACGTGGGACTGGCACTTCGAAAGC C29 5A AAAATGGCCTACAGTTTA GCTCGGTACC W31 5A CAGAATC GCCAATGACATGTCAAGGAAGAAGCATCTGAGATGTTAGTCTAGATAT C32 6A GTCAAGGAAGAAGCATCTGAGA GCCTAGTCTAGATAT 234 ... AAATGAGCCCAACAAAG CCGAGAAAAACATT I9 7A- R9 8A AATTTGATGCTCGACAGGCT GCCGCGGAGACATGG W10 1A CAATCCGGGAGACA GCTGGTGATGAAAA F11 6A- L11 7A- L11 8A- G11 9A TAGCCACACTT...

Ngày tải lên: 08/03/2014, 16:20

7 404 0
Báo cáo y học: " The influence of psychiatric screening in healthy populations selection: a new study and metaanalysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality traits" ppt

Báo cáo y học: " The influence of psychiatric screening in healthy populations selection: a new study and metaanalysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality traits" ppt

... heterogeneity or lack of data about ethnic origin. d Excluded because of unavailable data. e Data referred to SardiNIA sample. f Data referred to BLSA (Baltimore Longitudinal Study of Aging) sample. Minelli ... 1 Meta-analysisof5-HTTLPRLLversuscarriersSallele. Meta-analysis of association studies of serotonin transporter gene and anxiety-related personality traits measured by NEO an...

Ngày tải lên: 11/08/2014, 15:22

12 401 0
Báo cáo y học: "The use of medicinal plants in the transhimalayan arid zone of Mustang district, Nepal" pps

Báo cáo y học: "The use of medicinal plants in the transhimalayan arid zone of Mustang district, Nepal" pps

... Sonam Gurung, Maila Gurung, Chyaa Lama, Ram Chandra Thakali, Mangala Lalchan, Shyam Prasad Lalchan, Amchi Tsampa Ngawang Gurung, Amchi Thurthock Lama, Amchi Nengma Lama, Chendhen Gurung, Laxhi ... Bista, Raju Bista, Maya Bista, Amchi Gyasto Bista, Tsering Wangmo Bista, Amchi Tensing Bista Lama, Pema Dolma Bista, Chandup Gyato Bista, Chime Dolkar Bista, Tsewang Bista, Tashi Bista, Sonam Sangmo...

Ngày tải lên: 10/08/2014, 09:21

11 504 0
Báo cáo y học: "Diagnostic use of infrared thermography in a patient with chronic pain following electrocution: a case report" doc

Báo cáo y học: "Diagnostic use of infrared thermography in a patient with chronic pain following electrocution: a case report" doc

... Spanswick 2 Addresses: 1 Department of Obstetrics and Gynecology, University of Calgary, Calgary, AB, Canada 2 Calgary Health Region Chronic Pain Centre, Calgary, AB, Canada Email: JJ* - john.jarrell@calgaryhealthregion.ca; ... case report that infrared thermography may be of use in the documentation of abnormalities associated with chronic pain following survival after electrocut...

Ngày tải lên: 11/08/2014, 14:20

4 455 0
Báo cáo y học: " Rational use of computerized protocols in the intensive care unit" ppt

Báo cáo y học: " Rational use of computerized protocols in the intensive care unit" ppt

... widespread mandatory use of guidelines and protocols [15]. Standardization might be perceived as an attack on clin- icians’ assumption that they possess special and ineffable wisdom in clinical matters ... therapy staffs of the Intermountain Respiratory Intensive Care Unit and of the Shock- Trauma/Intermountain Respiratory ICU, and to the Respiratory Care Department of the LDS Hos...

Ngày tải lên: 12/08/2014, 18:21

6 318 0
Báo cáo y học: "Successful use of therapeutic hypothermia in an opiate induced out-of-hospital cardiac arrest complicated by severe hypoglycaemia and amphetamine intoxication: a case report" pdf

Báo cáo y học: "Successful use of therapeutic hypothermia in an opiate induced out-of-hospital cardiac arrest complicated by severe hypoglycaemia and amphetamine intoxication: a case report" pdf

... the arrival of the ambulance and emergency physician was 9 minutes, the initial cardiac rhythm was asystole and t he cause of the arrest was non-cardiac. After 8 minute s of standard advanced cardiac ... out -of- hospital cardiac arrest complicated by severe hypoglycaemia and amphetamine intoxication: a case report. Scandinavian Journal of Trauma, Resuscitation and Emergency Med...

Ngày tải lên: 13/08/2014, 23:21

3 267 0
Báo cáo y học: "Shared expression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis" pdf

Báo cáo y học: "Shared expression of phenotypic markers in systemic sclerosis indicates a convergence of pericytes and fibroblasts to a myofibroblast lineage in fibrosis" pdf

... skin The distribution of myofibroblasts was investigated using the 1A4 monoclonal antibody against α-SMA. In normal skin, α- SMA immunostaining was predominantly restricted to microv- ascular ... ventricular function, or if haemodynamically significant pericardial effusion was detected by echocardiography. A greater than four-fold eleva- tion of creatinine kinase accompanied by the c...

Ngày tải lên: 09/08/2014, 07:20

11 397 0
Báo cáo y học: "The role of patient expectations in predicting outcome after total knee arthroplasty" ppsx

Báo cáo y học: "The role of patient expectations in predicting outcome after total knee arthroplasty" ppsx

... stated. Contingency analyses were used to examine associations between categorical varia- bles. Bivariate analyses (Spearman rank or Pearson correla- tions, as appropriate) were used to examine ... (if any) of the following variables made a unique significant con- tribution to explaining the variance in satisfaction and in global outcome 2 years after TKA: baseline expectations, the a...

Ngày tải lên: 09/08/2014, 14:22

13 315 0
Báo cáo y học: "The prediction of discharge from in-patient psychiatric rehabilitation: a case-control study" docx

Báo cáo y học: "The prediction of discharge from in-patient psychiatric rehabilitation: a case-control study" docx

... other variables. The data was colle cted and analysed by the lead author. We consulted a statistician before analysing the data and carried out the anal ysis using Minitab for Windows. Ethical approval The ... esidential and nursing care placements are in out -of- are a treatments and these cost on a verage 64% more than local placements [18]. Although out -of- area placements are com...

Ngày tải lên: 11/08/2014, 15:22

6 437 1
Từ khóa:
w