Báo cáo y học: " "Metabolic staging" after major trauma - a guide for clinical decision making?" doc
Báo cáo y học: " "Metabolic staging" after major trauma - a guide for clinical decision making?" doc
... Injury 2009, 40(Suppl 4):S2 7-3 5.
doi: 10.1186/175 7-7 24 1-1 8-3 4
Cite this article as: Stahel et al., "Metabolic staging" after major trauma - a
guide for clinical decision making? Scandinavian ... phases after major trauma. The authors
conclude that a better understanding of these pathophys-
iological events may provide the treating clinician...
Báo cáo y học: "Metabolic syndrome in rheumatic diseases: epidemiology, pathophysiology, and clinical implications" doc
... Neumann E, Müller-
Ladner U: The potential of adiponectin in driving arthritis. J
Immunol 2006, 176:446 8-4 478.
65. Sada KE, Yamasaki Y, Maruyama M, Sugiyama H, Yamamura M,
Maeshima Y, Makino H: Altered ... mmol/L
a
Europeans, Sub-Saharan Africans, and Eastern Mediterranean and Middle East (Arab) populations;
b
South Asians and Ethnic South and Central
Americans. HDL, high-density lip...
Báo cáo y học: "Bone healing after median sternotomy: A comparison of two hemostatic device" pdf
... 2 Partial Healing 1 Total Healing 2
Partial Healing 1 No Healing 0 Total Healing 2
Partial Healing 1 Total Healing 2 Total Healing 2
Total Healing 2 No Healing 0 Partial Healing 1
Total Healing ... Healing 2 Partial Healing 1 Total Healing 2
Partial Healing 1 Partial Healing 1 Total Healing 2
Total Healing 2 Partial Healing 1 Total Healing 2
Total Healing 2 No Healing 0 Total Healing 2
Mean 1...
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc
... S10 0A8 was further
ascertained by amino-acid sequencing, using Edman degra-
dation. As S10 0A9 has a blocked N-terminal amino acid,
analysis of the protein was carried out by mass spectrometry.
The ... GTPcS-loaded Rac2, MgSO
4
and an optimal
amount of arachidonic acid determined for each assay of
oxidase activation [12]. The rate of O
2
–
production by the
activated NADPH oxidase was ca...
Báo cáo y học: "Identification of citrullinated α-enolase as a candidate autoantigen in rheumatoid arthritis" doc
... Sugaya M, Hanagiri T, Yasumoto K: [Tumor marker in
primary lung cancer]. J UOEH 2004, 26:47 3-4 79.
38. Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M,
Nagasaki M, Nakayama-Hamada M, ... Lopez-Longo FJ, Menard HA: The Sa sys-
tem: a novel antigen-antibody system specific for rheumatoid
arthritis. J Rheumatol 1994, 21:102 7-1 033.
20. Nakashima K, Hagiwara T, Ishigami A,...
Báo cáo y học: "The promise and limitations of population exomics for human evolution studies" doc
... the application of
exome data to human population genetics. We argue that
exomes will allow many important and detailed analyses
that are not possible with SNP arrays because of
ascertainment ... presented by
cryptic paralogs. Copy number variation is prevalent and
remains poorly characterized in humans. Reads from
exons that are absent from the capture target, perhaps
because they on...
Báo cáo y học: "Comparison of solution-based exome capture methods for next generation sequencing" doc
... Finland), 1.2 μlof20μM forward and
reverse P E PCR primers (5’ -AATGATACGGCGAC
CACCGAGATCTACACTCTTTCCCTACACGACGC
TCTTCCGATCT-3’ and 5’-CAAGCAGAAGACGGCA
TACGAGATCGGTCTCGGCATTCCTGCTGAACCGC
TCTTCCGATCT-3’ ... II
enzyme (Agilent) was used for both PCRs. For the Nim-
bleGen SeqCap, primers 5’ -AATGATACGGCGAC-
CACCGAGA-3’ and 5’ -CAAGCAGAAGACGGCA
TACGAG-3’ were used at a concentration of 100...
Báo cáo y học: "Journal of Circadian Rhythms: 21st-century publishing for 21st-century science" docx
... natural to create a specialized Journal of Circa-
dian Rhythms.
This new journal, with an editorial board composed of
active researchers in a broad range of specialties from a
variety of nations, ... publica-
tion [4]. The Journal of Circadian Rhythms takes advantage
of BioMed Central's experience of launching over 100 on-
line journals to advance the publication of research on cir...
Báo cáo y học: "Video assisted thoracoscopic resection of a posterior mediastinal Castleman’s tumor" doc
... surgery;
report of a case]. Kyobu Geka 2004, 57(10):99 0-9 92.
11. Kita Y, Nogimura H, Ohi S, Kageyama Y, Matsushita K, Ito Y, Kobayashi R,
Syundo Y, Neyatani H, Suzuki K, et al: [Thoracoscopically ... hyperplasia, giant lymph node hyperplasia,
lymph node hamartoma, as well as benig n lymph node
lymphoma, was first described by Dr. Benjamin Castle-
man in a patient with solitary med...
Báo cáo y học: " Use of cracked maize as a carrier for NDV4 vaccine in experimental vaccination of chickens" pot
... which was soaked in water for
three days, with a daily change of water (1:3; w/v). After
the third day, it was sun-dried on a clean and well washed
surface this was for the birds in cage 3.
The ... of each dilution was inoculated
into 5 - 10 days old embryonated egg already prepared for
inoculation. The inoculated eggs were then sealed with
molten candle wax and incubated for...