Báo cáo y học: " "Metabolic staging" after major trauma - a guide for clinical decision making?" doc

Báo cáo y học: " "Metabolic staging" after major trauma - a guide for clinical decision making?" doc

Báo cáo y học: " "Metabolic staging" after major trauma - a guide for clinical decision making?" doc

... Injury 2009, 40(Suppl 4):S2 7-3 5. doi: 10.1186/175 7-7 24 1-1 8-3 4 Cite this article as: Stahel et al., "Metabolic staging" after major trauma - a guide for clinical decision making? Scandinavian ... phases after major trauma. The authors conclude that a better understanding of these pathophys- iological events may provide the treating clinician...

Ngày tải lên: 13/08/2014, 23:20

3 315 0
Báo cáo y học: "Metabolic syndrome in rheumatic diseases: epidemiology, pathophysiology, and clinical implications" doc

Báo cáo y học: "Metabolic syndrome in rheumatic diseases: epidemiology, pathophysiology, and clinical implications" doc

... Neumann E, Müller- Ladner U: The potential of adiponectin in driving arthritis. J Immunol 2006, 176:446 8-4 478. 65. Sada KE, Yamasaki Y, Maruyama M, Sugiyama H, Yamamura M, Maeshima Y, Makino H: Altered ... mmol/L a Europeans, Sub-Saharan Africans, and Eastern Mediterranean and Middle East (Arab) populations; b South Asians and Ethnic South and Central Americans. HDL, high-density lip...

Ngày tải lên: 09/08/2014, 10:23

9 310 0
Báo cáo y học: "Bone healing after median sternotomy: A comparison of two hemostatic device" pdf

Báo cáo y học: "Bone healing after median sternotomy: A comparison of two hemostatic device" pdf

... 2 Partial Healing 1 Total Healing 2 Partial Healing 1 No Healing 0 Total Healing 2 Partial Healing 1 Total Healing 2 Total Healing 2 Total Healing 2 No Healing 0 Partial Healing 1 Total Healing ... Healing 2 Partial Healing 1 Total Healing 2 Partial Healing 1 Partial Healing 1 Total Healing 2 Total Healing 2 Partial Healing 1 Total Healing 2 Total Healing 2 No Healing 0 Total Healing 2 Mean 1...

Ngày tải lên: 10/08/2014, 09:23

8 373 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

... S10 0A8 was further ascertained by amino-acid sequencing, using Edman degra- dation. As S10 0A9 has a blocked N-terminal amino acid, analysis of the protein was carried out by mass spectrometry. The ... GTPcS-loaded Rac2, MgSO 4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12]. The rate of O 2 – production by the activated NADPH oxidase was ca...

Ngày tải lên: 18/03/2014, 01:20

10 396 0
Báo cáo y học: "Identification of citrullinated α-enolase as a candidate autoantigen in rheumatoid arthritis" doc

Báo cáo y học: "Identification of citrullinated α-enolase as a candidate autoantigen in rheumatoid arthritis" doc

... Sugaya M, Hanagiri T, Yasumoto K: [Tumor marker in primary lung cancer]. J UOEH 2004, 26:47 3-4 79. 38. Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, ... Lopez-Longo FJ, Menard HA: The Sa sys- tem: a novel antigen-antibody system specific for rheumatoid arthritis. J Rheumatol 1994, 21:102 7-1 033. 20. Nakashima K, Hagiwara T, Ishigami A,...

Ngày tải lên: 09/08/2014, 07:20

9 397 0
Báo cáo y học: "The promise and limitations of population exomics for human evolution studies" doc

Báo cáo y học: "The promise and limitations of population exomics for human evolution studies" doc

... the application of exome data to human population genetics. We argue that exomes will allow many important and detailed analyses that are not possible with SNP arrays because of ascertainment ... presented by cryptic paralogs. Copy number variation is prevalent and remains poorly characterized in humans. Reads from exons that are absent from the capture target, perhaps because they on...

Ngày tải lên: 09/08/2014, 23:20

7 318 0
Báo cáo y học: "Comparison of solution-based exome capture methods for next generation sequencing" doc

Báo cáo y học: "Comparison of solution-based exome capture methods for next generation sequencing" doc

... Finland), 1.2 μlof20μM forward and reverse P E PCR primers (5’ -AATGATACGGCGAC CACCGAGATCTACACTCTTTCCCTACACGACGC TCTTCCGATCT-3’ and 5’-CAAGCAGAAGACGGCA TACGAGATCGGTCTCGGCATTCCTGCTGAACCGC TCTTCCGATCT-3’ ... II enzyme (Agilent) was used for both PCRs. For the Nim- bleGen SeqCap, primers 5’ -AATGATACGGCGAC- CACCGAGA-3’ and 5’ -CAAGCAGAAGACGGCA TACGAG-3’ were used at a concentration of 100...

Ngày tải lên: 09/08/2014, 23:20

18 481 0
Báo cáo y học: "Journal of Circadian Rhythms: 21st-century publishing for 21st-century science" docx

Báo cáo y học: "Journal of Circadian Rhythms: 21st-century publishing for 21st-century science" docx

... natural to create a specialized Journal of Circa- dian Rhythms. This new journal, with an editorial board composed of active researchers in a broad range of specialties from a variety of nations, ... publica- tion [4]. The Journal of Circadian Rhythms takes advantage of BioMed Central's experience of launching over 100 on- line journals to advance the publication of research on cir...

Ngày tải lên: 10/08/2014, 09:20

2 199 0
Báo cáo y học: "Video assisted thoracoscopic resection of a posterior mediastinal Castleman’s tumor" doc

Báo cáo y học: "Video assisted thoracoscopic resection of a posterior mediastinal Castleman’s tumor" doc

... surgery; report of a case]. Kyobu Geka 2004, 57(10):99 0-9 92. 11. Kita Y, Nogimura H, Ohi S, Kageyama Y, Matsushita K, Ito Y, Kobayashi R, Syundo Y, Neyatani H, Suzuki K, et al: [Thoracoscopically ... hyperplasia, giant lymph node hyperplasia, lymph node hamartoma, as well as benig n lymph node lymphoma, was first described by Dr. Benjamin Castle- man in a patient with solitary med...

Ngày tải lên: 10/08/2014, 09:22

4 314 0
Báo cáo y học: " Use of cracked maize as a carrier for NDV4 vaccine in experimental vaccination of chickens" pot

Báo cáo y học: " Use of cracked maize as a carrier for NDV4 vaccine in experimental vaccination of chickens" pot

... which was soaked in water for three days, with a daily change of water (1:3; w/v). After the third day, it was sun-dried on a clean and well washed surface this was for the birds in cage 3. The ... of each dilution was inoculated into 5 - 10 days old embryonated egg already prepared for inoculation. The inoculated eggs were then sealed with molten candle wax and incubated for...

Ngày tải lên: 12/08/2014, 04:20

5 285 0
w