Báo cáo y học: "CapZ-lipid membrane interactions: a computer analysis" docx

... to actin in yeast: biochemical mechanism and physiological relevance. J Cell Biol 2004, 164:567-580. 7. Yamashita A, Maeda K, Maeda Y: Crystal structure of CapZ: structural basis for actin filament ... Torres MA, Casella JF, Cooper JA: Identification and Characterization of an Actin-Binding Site of CapZ. J Cell Biol 1992, 116:923-931. 6. Kim K, Yamashita A, Wear MA, Maeda Y, Cooper JA: Ca...

Ngày tải lên: 13/08/2014, 23:20

... own lab. • ey have almost certainly never seen anyone blow glass. In fact, many of them may not know that test tubes were ever made of anything but plastic. • ey have always had ... Intheirlifetime,noonehaseverpipettedanythingby mouth. • DNAsequencing,peptidesynthesis,chemicalanalysis, and gene synthesis have always been farmed out to specialty companies rat...

Ngày tải lên: 09/08/2014, 20:22

... November 2009 Accepted: 8 February 2010 Published: 8 February 2010 References 1. Kocabay G, Cagatay A, Eraksoy H, Tiryaki B, Alper A, Calangu S: A case of isolated hepatic actinomycosis causing right ... specific and is clinically used as a marker of pancreatic, hepatobiliary and gastric malignancies [8]. This marker is often elevated in benign disease st ates of the hepato biliary syst...

Ngày tải lên: 11/08/2014, 14:21

... Reports Open Access Case report Amniotic membrane transplantation for wound dehiscence after deep lamellar keratoplasty: a case report Tetsuya Kawakita* 1,2 , Tamaki Sumi 1 , Murat Dogru 1,2 , Kazuo ... University, Tokyo, Japan, 160-8582 Email: Tetsuya Kawakita* - kawatetsu@gmail.com; Tamaki Sumi - ocularsurface@gmail.com; Murat Dogru - muratodooru@yahoo.com; Kazuo Tsubota - tsubota@sc....

Ngày tải lên: 11/08/2014, 10:23

... funded by the National Health and Medical Research Council (NHMRC) Australia and was supported by the Sypkes Family Trust (a charity organisation) through the Royal Hobart Hospital Research Foundation. ... expiratory volume in first second; FVC: Forced vital capacity; H- N: Healthy and never-smoking; LP: Lamina propria; Rbm: Reticular basement membrane (lamina reticularis; a layer attach...

Ngày tải lên: 12/08/2014, 11:22

... 695 +A, GGAGGCTTGG T AGGTGCTTT AAGAATAGTT TTT/AAAAACTATT CTTAAAGCAC CTACCAAGCC TCC, 696 +A, GGCTTGGTAGGTTTAGCTAGAA- TAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT- TAAGGCAGCACCTACCAAGCCTC,695+ 3A, ... GGCTTGGTAGGTTTAGCTAGAA- TAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+ 2A, GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTAT...

Ngày tải lên: 13/08/2014, 01:20

... Total cellular RNA was iso- lated, reverse transcribed to cDNA and MIP- 1a, MIP- 1b, and RANTES mRNA expression was analyzed by real time PCR assay. When macrophages were infected with recombinant ... b-chemokines.Human inflammatory cytokine quantitation was performed by cytometric bead array (CBA). Cytokine concentrations from three independent experiments are presented. Data were analyzed w...

Ngày tải lên: 13/08/2014, 01:20

... this study are either intrinsically electrostatically positive (Table 3) or are located in regions that are relatively basic. Many critical biological pathways are regulated by pro- tein-lipid interactions. ... Z-discs and are generally lethal [26]. Translocation of alpha-actinin from the cytosol to the plasma membrane may occur indirectly by interactions with the cytoplasmic tails of trans...

Ngày tải lên: 13/08/2014, 23:20

... because the management plan adopted by the GP was appropriate [25]. Similarly, in Holliday v Curtin, a GP was held not liable for failure to diagnose breast cancer on a young female based ... in standards, both certifi - cation processes are provided by a single profes sional body that is well-recognized and widely accepted in Australia and New Zealand, the Australasian Society of...

Ngày tải lên: 25/10/2012, 10:02

... anatomically as extraspinal (vertebral) or intraspinal (epidural, subdural, arachnoid, or intramedullary), of which the intramedullary type is quite rare and only fifty-three cases have been ... clinical manifestations included pain, paraparesis, spasticity, bowel and bladder in- continence, and sexual dysfunction 1,20 . However, in- flammatory reaction against the dead parasite is as- s...

Ngày tải lên: 25/10/2012, 10:56