Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc

Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc

Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc

... of creating the dynamical system in a fully automated way. Nonetheless, after the initial construction and analysis of the resulting system, the modeler may modify the values of the parameters so as to ... logical analysis to find all the steady states of the system [15]. Generalized logical analysis allows us to find all the steady states of a discrete dynam...

Ngày tải lên: 13/08/2014, 23:20

18 288 0
Báo cáo y học: " A method for studying decision-making by guideline development groups" potx

Báo cáo y học: " A method for studying decision-making by guideline development groups" potx

... from a broad thematic analysis of a subset of data, to extract data excerpts warranting fur- ther analysis. Identifying areas of interest One key assumption made by the research team, on the basis ... identify and track the development of the theme through the course of the GDG. In this way, themes of apparent importance to the process of decision-making are t...

Ngày tải lên: 11/08/2014, 05:21

9 408 0
Báo cáo y học: " Concomitant homozygosity for the prothrombin gene variant with mild deficiency of antithrombin III in a patient with multiple hepatic infarctions: a case report" pdf

Báo cáo y học: " Concomitant homozygosity for the prothrombin gene variant with mild deficiency of antithrombin III in a patient with multiple hepatic infarctions: a case report" pdf

... hepatic infarction is rare because of the richly anasta- mosing collateral arterial supply, and the dual blood sup- ply from the portal vein and hepatic artery. In this case, there was portal hypertension ... life-long anticoagulation. Consent Written informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the w...

Ngày tải lên: 11/08/2014, 12:20

3 355 0
Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx

... 5′- CCTGCGTCGAGA GAGCTC-3′. To quantitate the viral amplicon, a TaqMan dual 5′-6-carboxyfluorescein-and 3′-6-carboxytetramethylrhodamimine-labeled probe was used: 5′ -(FAM)-CAGTGGCGCCCGAACAGGGA- (TAMRA)-3′ ... proteins that are homologous to the yeast deacety- lase Sir 2 [14,15]. Finally, the Class IV contains enzymes whicharerelatedtothoseofClassIandClassII,buta sequence analysis sho...

Ngày tải lên: 12/08/2014, 01:21

10 386 0
Báo cáo sinh học: " A method for the dynamic management of genetic variability in dairy cattle" pot

Báo cáo sinh học: " A method for the dynamic management of genetic variability in dairy cattle" pot

... up habits already well-known as harmful for ge- netic gains and additionally detrimental for a good management of genetic variability. Because of the future challenging situation for dairy cattle ... drift. Second, as a major constraint, the average EBV of the future individuals for an overall combination of many traits of economical importance, was set to a desi...

Ngày tải lên: 14/08/2014, 13:22

22 266 0
Báo cáo y học: "A method for high-throughput gene expression signature analysis" ppt

Báo cáo y học: "A method for high-throughput gene expression signature analysis" ppt

... document containing raw LMF data used to assess the stability of the LMF method (in the tab-delimited .txt file format; Additional data file 7); and a document containing raw LMF data from the analysis of the ... fileAdditional data file 6A document containing raw LMF data used to assess the stability of the LMF methodA document containing raw LMF data used to assess...

Ngày tải lên: 14/08/2014, 16:21

6 269 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo toán học: "A formula for the bivariate map asymptotics constants in terms of the univariate map asymptotics constants" pps

Báo cáo toán học: "A formula for the bivariate map asymptotics constants in terms of the univariate map asymptotics constants" pps

... constants t g and p g also appear. In 1993, the author [18] showed that many natural families of maps satisfy asymptotic formulas similar to (1) in which the same constants t g and p g appear in the coefficients. So ... variety of maps on surfaces and the parameters t g (r) and p g (r) arise in the corresponding bivariate asymp- totics for maps as well as embeddable graphs. The...

Ngày tải lên: 08/08/2014, 12:23

14 333 0
Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx

Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx

... 5'-CTGG- TACGCGATCAGAAAGC-3'; and probe, 5'-FAM- CAGCCGCAGTACTACC-3' – Amplicon length = 72 bp. As an internal control, a set of GAPDH primers from Applied Biosystems (ASSAY ... 5'-CAGTAGCGTGGGCATTT- TCTG-3'; reverse primer, 5'-CCTCGCCGGCAACAAAA-3'; and probe, 5'-FAM-CTCCAGGCGGACTTC-3' – Amplicon length = 59 bp; and 4) gB: forward primer,...

Ngày tải lên: 12/08/2014, 04:21

13 267 0
Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps

Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps

... primer, 5'- AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGG- TACGCGATCAGAAAGC-3'; and probe, 5'-FAM- CAGCCGCAGTACTACC-3' – Amplicon length = 72 bp. As an internal control, ... of McKrae. At the indicated times post infection the cells were harvested and reacted with Annexin-V or 7-ADD dye to analyze apoptosis and cell death respectively and FACS analysis w...

Ngày tải lên: 12/08/2014, 04:21

13 468 0
w