... Journal compilation ê 20 06 FEBS 3785 Activation of activating transcription factor 2 by p38 MAP kinase during apoptosis induced by human amylin in cultured pancreatic b-cells Shaoping Zhang 1 , Hong ... p38 mitogen activating protein (MAP) kinase (p38 kinase) followed by caspase-3 acti- vation [24 ]. Mitogen-activated protein kinases (MAPK...
Ngày tải lên: 07/03/2014, 12:20
... shown). Kinetics of membrane binding The kinetics of binding to PL membranes of the zymogen factor X, activated factor X (factor Xa) and the active site inhibited form DEGR -factor Xa as well as the the factor ... Ca 2+ concentration at which half- maximum binding occurs. Kinetics of membrane binding Membrane binding experiments on factor X, factor Xa, DEGR -factor...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo y học: "Effect of increasing intraperitoneal infusion rates on bupropion hydrochloride-induced seizures in mice" pptx
... administration of bupropion HCl 120 mg/kg by bolus injection induced convulsions in 6 out of 10 mice (60% of convulsing mice) in group 1. Increasing the total time of IP infusion of bupropion ... percentage of convulsing mice and on odds of convulsing vs not convulsing Group* Intraperitoneal (IP) infusion time (min) No. of mice convulsing Convulsing mice Red...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Repression of anti-proliferative factor Tob1 in osteoarthritic cartilage" pps
... of the presence of Tob1 in normal and osteoarthritic chondrocytes. Tob1, originally identified as binding partner of Erb ('trans- ducer of Erb' [24]), is a member of a larger family ... solutions with increasing ethanol concentration, the specimens were incubated in xylene and finally embedded in paraffin wax. For in situ hybridization, paraffin-embedded sampl...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Inhibition of antithrombin by hyaluronic acid may be involved in the pathogenesis of rheumatoid arthritis" potx
... pathogenesis of RA. The principal plasma inhibitor of thrombin is antithrombin, a single-chain 51 kDa glycoprotein that is synthesized in liver. The inhibitory activity of antithrombin on thrombin is ... presence of HA, supporting the notion that HA could compete with heparin for the heparin-binding region of antithrombin. Remarkably, HA affected the inhibition b...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Induction of a B-cell-dependent chronic arthritis with glucose-6-phosphate isomerase" pptx
... This is an important feature of an animal model of RA because the human disease is already chronic when it becomes diagnosed. RA is most likely often preceded by many years of subclinical inflammatory ... 2004, 101:12646-12651. 40. Sakaguchi N, Takahashi T, Hata H, Nomura T, Tagami T, Yamazaki S, Sakihama T, Matsutani T, Negishi I, Nakatsuru S, Sakaguchi S: Altered thymic T-cell selec...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: "Activation of transforming growth factor-β1 and early atherosclerosis in systemic lupus erythematosus" pptx
... is properly cited. Abstract The efficiency of activating latent transforming growth factor (TGF)-β 1 in systemic lupus erythematosus (SLE) may control the balance between inflammation and fibrosis, ... Consequential dysregulation of B cell activity leads to production of systemic lupus ery- thematosus (SLE)-like autoantibodies [3] and development of a lupus- like il...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Dramatic changes in transcription factor binding over evolutionary time" pps
... Bradley RK, Li XY, Trapnell C, Davidson S, Pachter L, Chu HC, Tonkin LA, Biggin MD, Eisen MB: Binding site turnover produces pervasive quantitative changes in transcription factor binding between ... two point mutations (and not by insertions or deletions), suggesting that changes in TF occupancy are largely caused by the steady accumulation of small sequence changes [3]...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: " Number of addictive substances used related to increased risk of unnatural death: A combined medico-legal and case-record study" pps
... among unnatural deaths, and a relationship to additional use of drugs apart from alcohol was expected. Therefore a separate analysis was carried out for additional drugs and unnatural death apart from ... WJ: The association of trauma death and alcohol use in a rural state. J Trauma 1992, 33:737-742. 28. Klatsky AL, Armstrong MA: Alcohol use, other traits, and risk...
Ngày tải lên: 11/08/2014, 17:20
Báo cáo y học: "Prevalence of active hepatitis c virus infection in district mansehra pakistan" docx
... Idrees 5 Abstract Prevalence of active hepatitis C virus (HCV) infection in apparently healthy inhabitants of District Mansehra, Pakistan was surveyed during September, 2009 to May, 2010. Subjects of different ... role in the spontaneous clearance of HCV infection [34]. Abbreviations cDNA: complementary DNA; HCV: hepatitis C virus; IBGE: Institute of Biotechn...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: "Treatment of active lupus nephritis with the novel immunosuppressant 15-deoxyspergualin: an open-label dose escalation study" pps
... Treatment of active lupus nephritis with the novel immunosuppressant 15-deoxyspergualin: an open-label dose escalation study. Arthritis Research & Therapy 2011 13:R36. Submit your next manuscript ... before onset of the recent LN flare. Only one of four patients with WHO type V LN responded (partially) to DSG; the patient with WHO type III did not imp...
Ngày tải lên: 12/08/2014, 15:22
Báo cáo y học: " Number of active transcription factor binding sites is essential for the Hes7 oscillator" pptx
... in the number of binding sites or in the affinity of a binding site results in an increase of the Hill coefficient. This effect becomes stronger if the affinity of one of the binding sites is increased ... potential transcription factor binding sites in the Hes7 promoter [4], so why are no more than two of them active? ã Our numerical analysis...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: " Prediction of synergistic transcription factors by function conservation" ppsx
... properly cited. Synergistic transcription factors& lt;p>A new strategy is proposed for identifying synergistic transcription factors by function conservation, leading to the identification of 51 ... its functional co- Table 4 Significance of E2F1 synergy for different distance constraints and sensitivity/specificity for detecting synergistic E2F1 combinations by fun...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Quantification of global transcription patterns in prokaryotes using spotted microarrays" pot
... transformed by the sequencing of genomes, and more recently by global gene expression analyses using microarrays [1,2]. Microarrays contain DNA probes representing all coding sequences in a genome, ... 'abundant invariome' Genome Biology 2007, 8:R265 Open Access 2007Sidderset al.Volume 8, Issue 12, Article R265 Method Quantification of global transcription patterns...
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "MONKEY: identifying conserved transcription-factor binding sites in multiple alignments using a binding site-specific evolutionary model" ppsx
... CATTTGCCACTCACGAACAAGAATAAAAGAATTTAGGTATTCTAGAATGCCCAAAAGGTAACGGCAATACA YLR387C_Skud AAATTGCCACTTACGAAGGAGAATAAAACAGCTCAGATATTCTTAGACACTCCAAGGGCAGTGACAATACA YLR387C_Sbay AAATTGCCACTCAGGAAAGAGAAGTGATATAATTAGATGTTCT ... region. YLR387C_Scer AAATTGCCACTCACGAAAGAGAATAAAACGACTTAGTCAT-ATGCAATAGTCACAAGACGGTGGCAACACA YLR387C_Spar AAATTGCCACTCACGAAGGAGAATAAAACAACTCAGTCGTCATGCAATACCCAAAAGACGGTGGCAATAAA...
Ngày tải lên: 14/08/2014, 14:21